Ecology

Associations

Known prey organisms

Apanteles (Apanteles cp.) preys on:
Tacoma feriella
Atlides halesus

Based on studies in:
USA: Texas (Plant substrate)

This list may not be complete but is based on published studies.
  • P. L. Whittaker, 1984. The insect fauna of mistletoe (Phoradendron tomentosum, Loranthaceae) in southern Texas. Southw. Nat. 29:435-444, from p. 443.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 5849
Specimens with Sequences: 5244
Specimens with Barcodes: 4565
Species: 515
Species With Barcodes: 444
Public Records: 4135
Public Species: 388
Public BINs: 411
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen39

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen44

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen45

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen15

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen43

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen47

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez270

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen14

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez238

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles jft37

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCTATATTTTTTATTTGGTTTATGAGCTGGAATATTAGGATTTTCAATAAGACTAATTATTCGTTTAGAACTAGGAATACCAGGATCATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGATCACCAGATATATCTTTTCCACGAATAAATAACATAAGTTTTTGATTATTAATCCCTTCTTTATTTTTATTAATTATAAGAGGTTTTATTAATACAGGTGTAGGAACTGGATGAACAGTTTATCCACCATTATCCTTAATTTTAGGTCATGGAGGAATATCAGTAGATATAGGAATTTTTGCATTACATTTAGCAGGAGCATCATCTATTATAGGTGCAGTAAACTTTATTACTACTATTCTAAATATACGAGTTAATATATTTATTATAGATAAAATATCCTTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft37

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez27

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 187
Specimens with Barcodes: 189
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 100
Specimens with Barcodes: 109
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez18

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 61
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez15

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez19

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez17

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 50
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez80

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez84

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez67

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez71

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez74

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez49

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 58
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez43

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez51

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 51
Specimens with Barcodes: 123
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez33

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez39

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 58
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez50

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez96

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez98

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez100

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez114

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez115

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez91

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez106

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez113

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez109

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez151

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez142

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 49
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez122

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez123

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez156

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez158

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez159

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez163

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez171

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez170

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez215

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez200

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez194

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez216

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez208

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez31

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTTTCAATAANAATAATTATTCGTTTAGAATTAGGAACACCAAATTATTTAATTGGTAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCCTTATTTTTATTAATTTTAAGTAGATTTATTAATATAGGTGTTGGTACTGGATGAACAGTATATCCACCATTATCATTAATTATAGGCCACGGTGGATTATCAGTTGATATAAGAATTTTTTCTTTACACTTAGCAGGAGCATCATCTATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTATTATAGATAAAATATCATTATTTTCTTGATCAGTTTTTATTACAGCTATTTTATTATTACTATCATTACCTGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTTGATCCAGCAGGAGGAGGAGATCCAATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez31

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez59

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATACTAGGATTTTCTATAAGCTTAATCATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATATTTAGAGGATTTATTAACACTGGTGTAGGTACAGGATGAACTGTATATCCACCATTATCTTTAATCTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTCGCCTTACATTTAGCTGGGGCATCCTCAATTATAGGAGCCATTAATTTTATTACAACTATCTTAAATATACGAGTTAAACTATTTATTATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGACCGAAATTTAAACACTAGATTCTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez59

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez41

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 39 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTCATATTCGGTTTATGAGCTGGAATATTAGGATTTTCCATAAGTTTAATTATCCGTTTAGAGCTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTACTATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTTGATATAAGAATTTTTGCATTACATTTAGCAGGAGCATCTTCAATCATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTCAACATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez41

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez101

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez107

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTATATTTCATATTTGGTATATGAGCTGGAATACTAGGATTTTCAATAAGATTAATTATTCGATTAGAACTTGGTATACCAGGATCTTTAATTGGTAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTCATAGTTATACCAGTTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATCCCATCATTATTTCTATTAGTATTTAGAGGTTTTATTAATATAGGTGTAGGTACAGGTTGAACAGTTTATCCACCATTATCATTAATCTTAGGTCATGGTGGTATATCAGTAGACATAGGAATTTTCGCATTACATCTTGCTGGTGCTTCATCTATTATAGGAGCAATTAATTTTATCACTACAATTTTAAATATACGAGTTAATTTATTTAATATAGATAAAATATCATTATTCATTTGATCAGTTTTTATTACTGCTATCTTATTATTATTATCCTTACCCGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGTTTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTAAAACAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez107

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez96

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTTTTAATATTTAGAAGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATACCCTCCATTATCATTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAATATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACTGCTATTTTATTATTATTATCATTACCTGTATTAGCGGGTGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez94

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNTNCTTTTTATTTGGTTTATGATCAGGAATACTAGGATTCTCTATAAGATTAANTATTCGATTAGAATTAGGAACACCTAATCAATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCCCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAATTCCATTAATATTAGGAGCACCCGATATATCATTCCCACGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTAAGAAGATTTATTAATATAGGTGTTGGTACTGGTTGAACAGTTTATCCTCCATTATCATTAATTTTAAGTCATGGAGGTTTATCTGTAGACATAAGAATTTTTTCTTTACATTTAGCAGGAGCATCTTCAATTATAGGAGCTATTAACTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTATTATAGATAAAATATCATTATTTTCCTGATCAGTTTTTATTACAGCTGTATTACTTTTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez94

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez98

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATCATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCCCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATATTTAGTGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATACCCACCATTATCTTTAATTTTAGGACATGGAGGTATATCAGTAGACATAAGAATTTTTGCATTACATTTGGCTGGGGCATCCTCAATTATAGGAGCAATCAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATTATAGATAAAATATCATTATTTATCTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez95

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATACCCACCATTATCTTTAATTCTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAATTATTTATAATAGATAAAATGTCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGACCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez95

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez97

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAACACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATTATAGGGGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCACTACCTGTATTAGCAGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez97

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez86

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTCGGTTTATGATCAGGTATATTAGGATTTTCAATAAGTCTAATCATTCGATTAGAATTAGGTATACCAGGATCATTAATTAGAAATGACCAAATTTATAATAGTATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTCTAATATTAGGAGCCCCAGATATATCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTAATTCCTTCATTATTTTTACTAATTTTTAGTAGATTTATTAATATAGGAGTTGGAACAGGATGAACAGTATATCCCCCCTTATCTTTAATTTTAGGTCATGGAGGTATATCAGTTGACATAAGAATTTTCGCATTACATTTAGCTGGAGCATCATCAATTATAGGAGCAGTAAACTTTATTACTACAATCCTAAATATACGAGTTAATTTATTTATTATAGACAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTACTATCATTACCTGTATTAGCCGGAGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCATCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez86

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez85

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGATTATGATCTGGAATATTAGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGTAATGACCAAATTTATAATAGTATTGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATGATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCTTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTCTTTTAATTTTTAGAAGATTTATTAATATTGGAGTAGGAACAGGTTGAACAGTTTATCCACCTTTATCCTTAATTTTAGGCCATAGAGGAATATCAGTTGATATAAGAATTTTTGCTCTACATTTAGCAGGTATATCATCAATTATAGGAGCAGTCAATTTTATTACTACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTACATTTATTACAGCTATTTTATTGTTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGTGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez85

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez88

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez84

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGATTATGATCTGGAATATTAGGATTTTCAATAAGATTAATTATCCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGTATTGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTCTTTTAATTTTTAGAAGATTTATTAATATTGGAGTAGGAACAGGTTGAACAGTTTATCCACCTTTATCATTAATTTTAGGTCACAGAGGAATATCAGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGTATATCATCAATTATAGGAGCAATTAATTTTATTACTACTATTATAAATATACGAATTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCCACTTTTATTACAGCTATTTTATTATTATTATCACTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez83

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGTTTATGGGCCGGAATATTAGGATTTTCAATAAGATTAATTATCCGTCTAGAATTAGGAATACCTGGATCACTTATTGGAAATGATCAAATTTATAACAGAATTGTTACATCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCGTAATAATTGGGGGTTTTGGAAATTGATTAATTCCATTAATACTTGGAGCACCAGATATATCCTTCCCACGTATAAATAACATAAGATTTTGATTATTAATTCCATCATTATTTCTTCTTATATTTAGGGGATTTATTAATATAGGAGTTGGAACAGGGTGAACAGTATACCCTCCATTATCATTAATTTTAGGTCATGGAGGTATATCAGTAGATATAGGAATTTTTTCCCTTCATCTTGCTGGAGCATCATCAATTATAGGTGCTATTAATTTTATTACCACAATTTTAAATATACGTGTTAATATATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTACTTCTTTCACTTCCAGTACTTGCAGGAGCAATTACTATATTATTAACTGATCGAAATCTAAATACAAGTTTTTTTGACCCTGCAGGAGGAGGAGATCCAATCTTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez83

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez82

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATATTTTTTATTTGGCTTATGAGCTGGAATATTAGGATTCTCAATAAGATTAATTATTCGTTTAGAATTAGGAACACCCGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCACACGCTTTTATCATAATTTTTTTTATGGTTATACCTGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTACTACCATCTTTATTATTATTAATTTTTAGAAGATTTATTAATATAGGTGTAGGAACAGGATGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATAGTGGTATATCAGTAGATATAAGAATTTTTTCATTACATCTTGCAGGAGCCTCATCTATTATAGGAGCTGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATAAATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACAGCTATTTTACTTTTATTATCTCTACCAGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCATCTGGTGGAGGTGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez82

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez81

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGATTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAATACCTGGATCTTTAATTGGAAATGATCAAATTTATAATAGTATTGTTACATCACACGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTTCCACGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTTTATTAGTTATAAGAAGATTTATTAATACTGGTGTAGGAACTGGATGAACTGTTTATCCTCCATTATCTTTAATTTTAGGACACGGAGGTATATCAGTAGATTTAAGAATTTTTGCTTTACATTTAGCTGGAGCATCATCTATTATAGGAGCCGTAAATTTTATCACTACTATTTTAAATATACGAGTAAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCCATTTTATTACTATTATCACTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTCGATCCAGCTGGAGGTGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez81

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez80

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTCGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCATTAATATTAGGAGCCCCTGATATATCATTTCCACGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTCTATTAGTATTTAGAGGTTTCATTAATACTGGTGTAGGAACAGGATGAACAGTATATCCCCCATTATCCCTAATTTTAGGTCATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGGGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTCTTAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTACTATTATCTTTACCTGTATTAGCAGGTGCTATCACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez79

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGGAAATGATCANATTTATAATAGNNNTGTTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCANTAATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGNNATATCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACAGTATATCCACCATTATCTCTAATTTTAGGTCATGGAGGAATATCAGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCTTCTTCAATCATAGGGGCAGTTAATTTTATTACAACTATTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTACTATTATCTTTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTCGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez79

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez78

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGGATTTTCAATAAGTTTAATTATTCGATTAGANTTAGGAATACCTGGTTCATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACATCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATAATTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACAGTATATCCACCCTTATCTTTAACCTTAGGACATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATCTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCATTACCTGTATTAGCAGGTGCTATTACAATATTATTAACCGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGACCCAATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez78

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez77

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATACTTTATATTCGGTTTATGGGCCGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTACTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATCTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTTCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAACATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCCATTTTACTATTATTATCATTACCTGTATTAGCAGGTGCTATCACAATACTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGTGGAGATCCAATCCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez77

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez64

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGGATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTCACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATANCCTCCATTATCTTTAATTTTAGGACATGGAGGAATATCNGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGANNATCATCAATTATAGGNGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATNATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTANTATTATTATCANTACCTGTATTAGCNGGTGCTATTACAATATTATTAACTGACCGAAATTTAAANACAAGATTTTTTGATCCAGCTGGTGGAGGAGANCCAATTNTATANCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez64

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez67

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGAATATGATCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAAATAGGTATACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAATTCCATTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATATTTAGAAGATTTATTAATATTGGAGTTGGTACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGTATATCAGTAGATATAAGAATTTTTTCATTACATCTTGCTGGAGCAAGATCTATTATAGGAGCAATTAATTTTATCACTACAATTTTAAATATACGAATTAAATTATTTATTATAGATAAAATATCATTATTTACTTGATCAGTTTTTATTACTGCTATTCTTCTTTTATTATCTTTACCCGTATTAGCAGGTGCTATTACAATATTATTAACTGACCGTAATTTAAATACAAGTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez68

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATAGTAGGATTTTCAATAAGATTAATTATTCGACTAGAATTAGGTATACCAGGTGCTTTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCACATGCCTTTATTATAATTTTCTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATCCCATTAATACTAGGATCTCCTGATATATCCTTCCCTCGAATAAATAATATAAGATTTTGACTTTTAATTCCATCATTATCATTATTATTAATAAGAGGCTTCATTAATATAGGGGTAGGAACAGGTTGAACAGTTTACCCACCCTTATCATTAATTTTGGGACATGGTGGTATATCAGTAGATATAGGAATCTTTGCTCTACATCTTGCTGGTGCATCATCTATTATAGGAGCAATTAATTTTATTACCACAATTTCAAATATACGAATTAACCTATTTAATATAGATAAAATATCATTATTCACTTGATCAGTTTATATTACTGCTATTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCAATCACTATACTATTAACTGACCGAAATTTAAATACAAGTTTTTTTGACCCATCTGGTGGAGGTGACCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez68

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez72

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNGATCCGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAACACCAAATCATCTTATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATATCTTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTAAGAAGATTTATTAATATAGGAGTTGGAACTGGATGAACTGTTTATCCACCACTATCATTAATTTTAGGTCATGGTGGTATATCTGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGAATATCATCTATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAGTAAAATTCTTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACAATATTACTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGTGATCCAATTTTATACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez72

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez65

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATGATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTTTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCACTACCTGTATTAGCAGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez65

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez69

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGTATTATATTTTATATTTGGAATATGAACTGGAATATTAGGATTCTCAATAAGATTAATTATTCGAATGGAATTAGGAATACCAGGATCACTAATTGGAAATGATCAAATTTACAATAGAATTGTTACATCACACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCGCCAGATATATCATTTCCTCGAATAAATAACATAAGATTTTGACTACTAATTCCCTCATTACTTCTTTTAGTACTAAGAGGTTTTATTAATACTGGTGTAGGAACAGGCTGAACTGTCTATCCCCCACTATCACTAATTTTAGGTCATGGTGGAATATCAGTTGATATAGGAATTTTTGCATTACATCTTGCCGGTGCATCATCTATCATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATCTGATCAGTATTTATTACAGCTATCTTATTATTATTATCATTACCTGTTTTAGCAGGGGCTATTACTATACTATTAACTGACCGAAACTTAAATACAAGATTCTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez69

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez71

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTCATATTTGGATTATGATCTGGTATATTAGGATTTTCAATAAGTTTAATTATCCGATTAGAATTAGGAATACCTGGTTCATTAATTAGAAATGATCAAATTTATAATAGTATTGTAACATCCCATGCCTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTCTACTTATTTTTAGAAGATTTATTAATATTGGTGTAGGAACAGGATGAACAGTTTATCCTCCACTATCATTAATTTTAGGTCATGGTGGTATATCTGTAGATATAAGAATTTTTGCTTTACATTTAGCTGGTGCCTCTTCAATTATAGGAGCAGTAAATTTTATTACTACTATTATAAATATACGAGTTAATCTTTTTAATATAGATAAAATATCACTTTTTATTTGATCAGTATTTATTACAGCTATTTTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCAGCCGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez61

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGAATTTGAGCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAACTAGGAACACCTAGATCATTAATTATAAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATTATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGATTAATTCCTCTAATACTAGGAGCCCCAGATATATCATTCCCACGTATAAATAATATAAGATTCTGATTATTAATTCCTTCATTATTTTTTTTAATTTTTAGAAGATTAATTAATACTGGTATAGGAACAGGATGAACAGTTTATCCACCTTTATCTTTAATTTTAGGCCATGGAGGTATATCTGTAGATATAAGAATCTTTTCTTTACATTTAGCAGGAATATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAATTAATTTATTTACTATAGATAAAATATCTTTATTTACTTGATCAGTTTTAATTACAGCAATTCTTTTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGACCCAATCTTATACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez61

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez73

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTATATTTTTTATTTGGCTTATGAGCTGGGATACTTGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGTTCACCTGGACCATTTATTAATAATGATCAAATTTACAATAGAATTGTAACATCACACGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGATTCGGAAATTGATTAATTCCGCTAATACTAGGTGCTCCAGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTTTATTAATTTTTAGAAGATTTATTAATACAGGTGTAGGAACAGGTTGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCATGGAGGTATATCAGTTGATATAAGAATTTTTGCATTACATTTAGCTGGAGCATCTTCTATTATAGGTGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATATATTTACTATAGATAAAATATCTCTTTTTATTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCTCTACCTGTTTTAGCAGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez73

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez74

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGGAATATTAGGATTTTCAATAAGACTAATTATTCGTCTTGAATTAGGTATACCGGGATCATTAATTATAAATGATCAAATTTATAACAGTATTGTTACCTCCCACGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGGGGATTTGGAAATTGATTAATCCCTTTAATATTAGGGGCCCCAGACATATCCTTCCCACGAATAAATAATATAAGATTTTGACTTTTAATCCCCTCATTATTTTTATTAACACTTAGGAGATTCATTAATATCGGAGTAGGGACTGGATGAACAGTATACCCACCTTTATCATTAACTATAAGACACGGAGGAATATCTGTTGATATAGGAATTTTTGCCCTTCACTTAGCAGGGGCATCATCAATTATAGGTGCAATTAATTTTATTACAACCATTTTAAATATACGAACTAATCTTTTTTATATAGATAAAATATCATTATTTATCTGATCAGTTTTCATTACAGCTATTTTATTACTATTATCTTTACCTGTGTTAGCAGGGGCAATTACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTCGACCCTGCGGGGGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez50

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGAAACTGATTAATTCCATTAATATTAGGATCCCCTGATATATCATTTCCACGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTATATTAGTATTTAGAGGTTTCATTAATACTGGTGTAGGAACAGGATGAACAGTATATCCTCCATTATCCTTAATTTTAGGTCATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACTATTCTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTACTATTATCTTTACCTGTATTAGCAGGTGCTATCACAATATTATTAACTGACCGAAATTTAAATACNAGATTTTTTGATCCAGCTGGAGGAGGNGANCCNATTTTANACCAACATTTATNT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez42

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTATAAGAATTATTATTCGATTAGAATTAGGAACCCCAAATTCTTTAATTGGTAATGATCAAATTTATAATAGTATTGTAACTTCACACGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAATTTTATTAATGTTGGAGTAGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGACATAGTGGNATATCTGTTGATATAAGAATTTTNGCTTTANATTTAGCCGGAGCATCATCAATTATAGGGGCNATTAACTTTATTACNACTATTTTAAATATACGAGTTAATATATTTTCAATAGATAAAATATCATTATTTTCTTGATCAGTATTTATTACAGCAATTTTATTATTATTATCATTACCNGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACTNGATTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez42

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez60

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGAATTTGAGCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTAGATCATTAATTATAAATGATCAAATTTATAATAGTATCGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAACTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCTTTCCCACGTATAAATAATATAAGATTCTGATTATTAATCCCTTCATTATTTTTTTTAATTTTTAGAAATTTTATTAATACTGGGGTAGGAACAGGATGAACAATTTATCCACCTTTATCTTTAATTTTAGGTCATGGAGGTATATCTGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGAATATCCTCTATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAATTAATTCATTTTCTATAGATAAAATATCTTTATTTACCTGATCAGTATTAATCACAGCAATTCTTTTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGATCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez60

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez48

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTCATATTTGGATTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGTATACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTACTAATTCCATCATTATTTTTATTATTATTTAGAGGTTTTATTAATGTTGGAGTAGGGACAGGTTGAACAGTATATCCTCCATTATCATTAATTTTAGGTCATGGTGGTATATCAGTAGATATAGGAATTTTTGCATTACACCTTGCTGGTGCATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTCTAAATATACGAGTTAATATATTTGTTATAGATAAAATATCACTATTCACTTGATCAGTTTTTATTACTGCAATTCTACTTTTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTCGATCCAGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez48

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez49

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 46 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTATATTTTTTATTTGGATTATGAGCTGGAATACTTGGATTTTCAATAAGATTAATTATTCGACTAGAATTAGGATCACCTGGACCATTAATTAATAATGATCAAATTTATAATAGTATTGTAACATCCCACGCTTTTATTATAATTTTTTTTATAGTTATACCCGTAATAATTGGTGGATTCGGAAATTGATTAATTCCATTAATATTAGGTGCTGCCGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTCTTATTAATTTTTAGAAGATTTATTAATACAGGTGTAGGAACAGGTTGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCATGGAGGAATATCCGTTGATATAAGAATTTTTGCATTACATTTAGCTGGAGCATCTTCAATTATAGGTGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCACTTTTTATTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCTCTTCCTGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACCAGATTTTTCGATCCAGCTGGTGGAGGTGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez43

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAACACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTAATACCCGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCCCCAGATATATCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCCTACTAATTTTTAGAAGATTCATTAATGTTGGTGTAGGAACAGGATGAACAATTTATCCACCCCTATCATTAATTTTAGGACATGGAGGTATATCAGTAGATATAAGAATTTTTGCTTTACATTTGGCTGGAGCATCCTCAATTATAGGTGCAATTAATTTTATTACAACAATTATAAATATACGAGTAAATCTTTTTATAATAGATAAAATATCTTTATTTATTTGATCAGTTTTTATTACAGCTATCTTATTATTATTATCATTACCTGTCTTGGCTGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez46

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATTCTAGGATTTTCTTTAAGATTAATTATTCGATTAGAATTAGGAACACCTAATTACTTAATTGGAAATGATCAAATTTATAATAGTATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTAAGAAGATTTATTAATACAGGTGTTGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGACATGGGGGAATATCTGTAGATTTAAGAATTTTTTCTTTACATCTTGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTTTTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCAATTCTTTTATTACTTTCCTTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCAGGAGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez46

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez58

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTCTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCTTACTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAACATACGAGTTAAACTATTTATAATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez58

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez47

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTCTATTTGGATTATGAGCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAATACCCGGATCATTAATTGGAAATGATCAAATTTACAATAGAATTGTAACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTTGGAGCCCCAGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTACTAGTATTTAGAAATTTTATTAACGTTGGTGTAGGAACAGGTTGAACAGTTTATCCTCCATTATCATTAATCTTAGGACATGGTGGAATATCTGTAGATATAGGAATTTTTGCCCTACATCTTGCAGGTGCAAGATCTATTATAGGAGCTATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTCGTTTGATCAGTTTTTATTACCGCTATTTTATTACTACTATCCTTACCTGTTCTAGCAGGAGCAATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez47

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez32

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 56 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTATATTTCTTATTTGGAATATGAGCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAACTAGGAACACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTCCCTCGAATAAATAACATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTTAGAGGTTTTATTAATATAGGTGTAGGAACAGGTTGAACAGTTTACCCCCCATTATCATTAAATTTAGGACATAGAGGTATATCAGTAGATATAGGAATTTTTGCTTTACATCTTGCCGGAGCATCATCTATTATAGGAGCAATTAATTTTATTACAACAATTTTAAACATACGAGTTAATTTATTTAATATAGATAAAATATCATTATTCATTTGATCAGTTTTTATTACAGCAATTCTATTATTATTATCATTACCAGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAATCTAAATACAAGTTTTTTTGATCCATCCGGTGGGGGTGATCCAATCTTATATCAACACCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez34

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTTTATTTGGTTTATGGGCCGGAATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAATACCTGGATCTCTAATTGGAAATGATCAAATTTATAATAGTATTGTTACATCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATCCCCTTAATACTTGGAGCACCAGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATCCCCTCATTATTTTTATTAATTTTTAGGGGATTCATTAATACCGGTGTAGGAACTGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCATGGTGGTATATCCGTAGATATAGGTATTTTTGCTTTACATTTAGCAGGAGCATCCTCTATTATAGGTGCAGTAAACTTTATTACTACTATTTTAAATATACGAGTTAATTTATTCATCATAGATAAAATATCTCTATTCATTTGATCTGTTTTTATTACAGCTATTTTATTATTACTATCTCTTCCTGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACCAGATTCTTTGATCCTGCAGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez29

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANTTTTATTAATACTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTTGATATAAGAATTTTTGCGTTACATTTAGCAGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAATTATTCAACATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez29

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez27

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTCATATTCGGTTTATGAGCTGGAATATTAGGATTTTCCATAAGTTTAATTATTCGTTTAGAGTTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACCATTTTAAATATACGAGTTAAACTATTCAACATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCCGGAGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez21

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NTATTATATTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGGGTAGGTACAGGATGAACTGTATATCCTCCATTATCTTTAATTTTAGGTCATGGAGGAATATCCGTAGATATAAGAATTTTTGCTTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCAGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGAGGTGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez24

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGNTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAATCCTAGGATTTTCAATAAGAATAATTATTCGATTAGAACTAGGTACACCCAATCATTTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCACGCCTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAACTGACTAATTCCTTTAATACTAGGAGCACCTGATATATCATTTCCCCGAATAAATAACATAAGATTTTGACTACTAATTCCCTCATTATTCTTATTAATTTTAAGGAGATTAATTAATATAGGGGTTGGAACTGGATGAACAGTATACCCCCCATTATCATTAATATCAAGACATAGAGGATTGTCCGTAGATATAAGAATTTTTTCATTACATTTAGCAGGAGCATCATCAATTATAGGAGCAATTAACTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTATCATAGATAAAATGTCATTATTTACTTGATCCGTATTTATTACAGCTATTCTATTACTATTATCTTTACCTGTATTAGCAGGCGCTATTACTATATTATTAACTGACCGAAACCTTAATACAAGATTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez07

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAACACCAAATTATTTAATTGGTAATGATCAAATTTATAATAGAATCGTTACATCTCACGCCTTTATCATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTAAGAAGATTTATTAATATAGGAGTTGGAACTGGATGAACAGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATATAAGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATCAATTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTGTTATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCTCTTCCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGTGGAGACCCNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez05

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATAAATAATATAAGATTTTGATTACTAATTCCATCATTATTTTTATTAATTTTAAGAAGATTTATTAATATAGGTGTTGGAACAGGATGAACAGTTTATCCACCACTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATAAGAATTTTTTCATTACACTTAGCTGGAATATCATCAATTATAGGAGCTATTAATTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTATTATAGATAAAATATCATTATTTATCTGATCAGTATTTATTACAGCTATTTTATTATTATTATCACTACCTGTATTAGCAGGTGCAATCACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez26

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 202 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGGAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTACTAATCCCTTCNTTATTCTTATTAATATTTAGAGGATTTATTAATACTGGAGTAGGTACAGGATGAACTGTATATCCACCANTATCTNTAATTCTAGGACATGGAGGGATATCCNTAGATATAAGAATTTTTNCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAANTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCCATTTTACTATTACTATCATTACCTGTATTAGCTGGAGCCATCACCATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez06

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 125 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGTATATGATCAGGAATAGTTGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTAATTATTTAATTGGAAATGATCAAATTTATAATAGTATTGTTACTTCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTCGGAAATTGATTAATTCCTTTAATACTTGGAGCACCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTACTAATTCCTTCACTATTTTTATTAATTTTAAGTAGATTTATTAATATAGGTGTTGGAACTGGTTGAACAGTTTATCCTCCATTATCTTTAATTTTAGGCCATGGAGGTATATCTGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGTGTAAAATTATTTATTATAGACAAAATATCACTATTTACATGATCAGTTTTTATTACAGCTATTCTACTATTATTATCTTTACCTGTTCTTGCTGGTGCAATTACTATACTATTAACAGACCGAAACTTAAATACAAGATTTTTTGATCCGGCTGGTGGTGGAGATCCAATTTTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez18

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCCATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGAAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCTTTAATACTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTCTATTAATATTTAGAAGATTTATTAATACCGGAGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGATCAATTAATTTTATCACAACTATTTTAAATATACGAGTTAAACTATTTATTATAGATAAAATATCATTATTTATCTGATCTATTTTTATTACTACCATTTTATTATTATTATCATTACCTGTACTAGCTGGTGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCTATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGATTATGATCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGTCTAGAATTAGGAACACCTAATCAACTTATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCTTTCCCACGAATAAACAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTAAGAAGATTTATTAATATAGGTGTAGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGTGGTATATCTGTAGATATAAGAATTTTTTCTTTACATTTAGCTGGAATATCATCTATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAGTAAAATTCTTTATTATAGATAAAATATCTTTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTTCTTGCAGGTGCAATTACTATATTATTAACAGATCGAAACTTAAATACAAGATTTTTTGATCCAGCTGGTGGTGGTGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez12

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTATATTTTTTATTTGGGATATGAGCTGGAATATTAGGATTCTCAATAAGTTTAATCATTCGATTAGAATTAGGAATACCTGGATCTTTAATTGGTAATGACCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATGATTTTTTTTATAGTTATACCAGTTATAATTGGAGGATTTGGAAATTGATTAATTCCACTAATATTAGGAGCACCAGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAGTATTTAGAGGTTTTATTAATGTTGGTGTAGGAACAGGCTGAACAGTTTATCCTCCATTATCATTAATTTTAGGACATGGTGGTATATCAGTAGATATAGGAATTTTTGCATTACACCTTGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACCACAATCCTAAATATACGAGTTAATTTATTCAATATAGATAAAATATCATTATTCATTTGATCAGTTTTTATTACTGCTATTCTTTTACTTTTATCATTACCCGTTCTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGTTTTTTTGATCCAGCTGGTGGAGGAGACCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez20

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 69 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACCTCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTATTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATACCCACCATTATCTTTAATCTTAGGTCACAGAGGAATATCTGTAGATATAAGAATTTTTGCTTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTCTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCACTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez15

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTCTTATTTGGTTTATGAGCCGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAAATCCTGGATCAATAATTGGAAATGACCAAATTTATAATAGTATTGTAACATCACATGCCTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTACTTCTTATTTTTAGAAGATTAATTAATATTGGAGTAGGAACAGGCTGAACAGTATATCCACCTTTATCATTAATTTTAAGTCATGGAGGTATATCAGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCTTCTTCTATTATAGGAGCTGTAAATTTTATTACTACAATTTTAAATATGCGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTCATTACAGCTATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTACTAACTGATCGAAATTTAAATACAAGATTCTTTGATCCAGCTGGTGGAGGAGACCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez19

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCCGGAATATTAGGATTTTCTATAAGTTTAATTATTCGGTTAGAACTGGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATCTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTTCCTTACATTTAGCTGGAACATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCCATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGTGGAGATCCAATCCTATACCNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez10

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATACTATATTTTTTATTTGGAATATGATCTGGAATATTAGGATATTCAATAAGATTAATTATTCGATTAGAATTAGGATCACCTGGATCTTTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGGGCCCCTGATATATCATTTCCACGAATAAATAACATAAGTTTTTGACTTTTAATTCCATCATTATTCTTACTAATTTTAAGAAGATTAATTAATACAGGTGTAGGAACAGGATGAACAATTTATCCTCCTTTATCCTTAAATTTAGGTCATAGAGGAATATCAGTTGATATAAGAATTTTCTCTTTACATTTAGCAGGAGCATCATCAATTATAGGTGCAATTAATTTTATTACAACAATTTTAAATATGCGAGTTAATTTTATAATTATAGATAAATTATCATTATTTATTTGATCAATTTTTATTACAACAATTTTACTACTTCTATCATTACCAGTATTAGCTGGAGCAATTACTATACTTTTAACAGATCGAAATTTAAATACAAGATTTTTTGACCCGGCAGGAGGAGGAGATCCAATTCTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez16

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTTGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGAAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCCTTAATATTAGGAGCTCCTGATATATCATTCCCACGAATAAATAATATGAGATTTTGATTATTAATTCCTTCATTATTTTTATTAGTATTAAGAAGATTCATTAACACTGGTGTAGGAACAGGTTGAACAGTATACCCTCCACTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATAAGAATTTTTGCTTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCTGGTGCCATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez09

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 42 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTTTGATCAGGAATACTCGGATTCTCTATAAGATTAATTATTCGATTAGAATTAGGAACACCTAATCAATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACATCTCACGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGCTTTGGAAATTGATTAATTCCATTAATGTTAGGAGCACCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCCTCATTATTTTTATTAATTTTAAGAAGATTTATCAATGTAGGAGTTGGAACTGGTTGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGATTATCAGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGAGCATCCTCAATTATAGGAGCCATTAATTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTATTATAGATAAAATATCATTATTTTCCTGATCAGTTTTTATTACAGCTATTTTACTATTATTATCCTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTTGACCCAGCTGGAGGAGGAGACCCAATCCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez03

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGAATTTGAGCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAACACCTAGATCATTAATTATAAATGATCAAATTTATAATAGTATTGTTACATCCCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCCCCAGATATATCTTTCCCACGTATAAATAATATAAGATTCTGATTATTAATCCCTTCACTATTTTTTTTAATTTTTAGTAGTTTTATTAATACTGGAGTTGGAACAGGATGAACAGTTTACCCACCCCTATCTTTAATTTTAGGTCATGGAGGTATATCTGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGAATATCCTCTATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAATTAATTCATTTTCTATAGATAAAATATCTTTATTTACCTGATCAGTATTAATTACAGCAATTCTTTTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAACTTAAATACTAGATTTTTTGACCCAGCAGGTGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez08

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGTTTATGATCAGGAATACTTGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACACCAAATTATTTAATTGGAAATGATCAAATTTATAATAGTATTGTTACATCACACGCTTTCATTATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGACATATCATTCCCACGAATAAATAATATAAGATTCTGATTATTAATTCCTTCATTATTTTTATTAATTTTAAGTAGATTTATTAATATAGGGGTAGGTACTGGATGAACAGTATATCCTCCATTATCATTAATTTTAGGTCATGGTGGATTATCTGTTGATATAAGAATTTTCTCTTTACATTTAGCAGGTGCTTCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGAGTAAAATTTTTTATTATAGATAAAATATCATTATTCTCTTGATCAGTTTTTATTACAGCAATTTTACTATTACTATCTCTTCCTGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez25

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTCGGTTTATGAACTGGAATATTAGGATTTTCTATAAGTTTGATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCCTCTTTATTCTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATACCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTGGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTTTTTATAATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACCGCCATTTTACTATTACTATCATTACCTGTATTAGCTGGTGCCATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez11

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 55 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATACTTTTTATTTGGATTATGATCTGGAATATTAGGATTTTCTTTAAGATTAATTATTCGTTTAGAACTAGGAATACCAGGTTCATTAATTAGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGATTTGGTAACTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCCTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCACTATTTTTATTAATTTTTAGAAGATTTATTAATACCGGTGTAGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAATTTTAGGCCATGGAGGAATATCAGTAGATATAAGAATTTTTGCATTACATTTAGCTGGGGCATCATCAATTATAGGTGCAATTAATTTTATTACCACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATCTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCTGGTGGTGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez23

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 53 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCNATAAGTTTAATTATTCGATTAGANTTAGGAATACCTGGATCATTAATTGGCAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTNGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACNATTTTAAATATACGAGTTAAAATATTTATNATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCACTACCTGTATTAGCAGGTGCTATTACAATATTATTAACTGACCGAAATTTAAANACAAGATTTTTTGANCCAGCTGGTGGAGGAGATCCAATTCTATANCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez22

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGCGCTATCACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez28

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATATTAGGATTTTCCATAAGTTTAATTATTCGTTTAGAGTTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGAANNNTCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGGGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTTGATATAAGAATTTTTGCCTTACATTTAGCAGGAGCATCTTCAATCATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTCAACATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez17

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 53 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTGGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTCGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCCCGAATAAATAATATAAGATTTTGACTATTAATTCCTTCATTATTTTTATTAATATTTAGTGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATACCCACCATTATCTCTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTCTAAATATACGAGTTAAAATATTCATTATAGATAAAATATCATTATTTACCTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCCGTATTAGCTGGAGCTATTACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez174

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGATTATGGTCGGGTATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAATTCCTGGTAGTTTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGGTTTGGGAATTGGTTAATTCCTTTAATATTAGGATCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATTAATATTAATTTTAAGAGGATTTATTAATGTAGGAGTTGGCACAGGTTGAACTGTTTATCCTCCTTTATCTTTGATTTTAGGACATGGTGGTATATCTGTTGATTTGGGAATTTTTTCTTTACATTTAGCCGGGGCTTCTTCAATTATAGGGGCTGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATTTTTTTTTTATAGATAAAATATCTTTATTTGTTTGATCTGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATCGAAATTTAAATACTAGATTTTTTGACCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez174

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez216

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATATTATATTTTATATTTGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGTATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACATCACATGCTTTTATTATAATTTTCTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCCTTAATATTAGGAGCACCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAGATTTATTAATACAGGAGTAGGAACTGGATGAACAGTTTACCCACCTTTATCTTTAATTATAAGACATAGAGGTATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGTGCATCCTCTATTATAGGAGCAATTAACTTTATTACAACTATTCTAAATATACGAGTAAATTTATTTATTATAGATAAAATATCTTTATTTATTTGATCTGTTTTCATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCCGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez186

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTTTATTTGGGTTATGAGCCGGAATATTAGGATTTTCAATAAGATTAATTATTCGACTGGAATTAGGAACACCAAAATCATTAATTGGTAATGAACAAATTTTTAATAGAATTGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTCTCATATTAGGAACACCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCATCTTTATTTTTATTAATTTTCAGGAGATTTATTAATATAGGTGTAGGAACAGGTTGAACAGTATATCCTCCATTATCATTAACTTTAGGACATAGTGGTATATCAGTAGATATAAGAATTTTTGCCTTACATTTAGCAGGAGCTTCTTCTATTATAGGTGCTGTAAATTTTATTACTACTATTTTAAATATACGAATTAAATTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACAGCAATTTTATTATTATTATCATTACCTGTTCTAGCTGGTGCAATTACAATATTATTAACTGATCGAAACTTAAATACCAGATTTTTTGATCCTTCCGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez186

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez208

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATNTTCTGTTTGGAATATGAGCAGGTATAATTGGATTTTCATTAAGATTAATTATTCGGCTAGAATTAGGAACACCCGGATCATTAATCGGAAATGATCAAATTTATAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCACAATAATCGGAGGTTTTGGAAATTGATTAATTCCATTAATACTGGGAGCACCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGACTTTTAATTCCTTCATTAATAATATTAATTTGTAGAAGATTTATTAATATTGGTACAGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAAACTTAGGTCATAGAGGTTTATCAGTTGATATAAGAATTTTTGCTTTACATTTAGCTGGTGCTTCTTCAATCATAGGAGCTGTAAACTTTATTTCTACCATCTTTAATATACGAATTAATATTTTTACTATAGATAAAATATCCTTATTTATTTGATCAGTATTTATCACAGCTATTTTACTCCTACTTTCATTACCAGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCTTCAGGAGGNGGAGATCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez218

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTTTATTTGGATTATGATCTGGAATATTAGGATTTTCCTTAAGAATTATTATTCGTCTAGAATTAGGTACCCCAAATTCATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATCCCCTCTTTATTTTTATTAATTTTTAGTGGTTTTATTAACACTGGTGTTGGAACTGGATGAACTGTTTATCCCCCATTATCACTAATTTTAGGTCATAGTGGTATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGTGCATCATCAATTATAGGAGCCATTAATTTTATTACAACTATTTTAAATATACGAATTAATTTTTTTAATATAGATAAAATATCATTATTTATTTGATCAGTATTCATTACAGCAATTCTTTTACTATTATCATTACCCGTATTAGCAGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTGCTGGTGGAGGAGATCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez218

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez207

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAATATACTTCATATTTGGTTTATGATCCGGTATAATTGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACACCTGGACCATTAATTAATAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGATCACCTGATATATCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTCTAGTAGACTTATTAATACTGGTGTTGGAACAGGATGAACAGTTTACCCACCCCTATCCTTAAATTTAAATCATAGAGGAATATCCGTAGATATAAGAATTTTTTCTTTACACTTAGCAGGTATATCATCTATTATAGGAGCAATTAACTTCATCTCCACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCTCTTTTTATCTGATCTGTTTTCATTACAGCTATTTTATTATTACTTTCATTACCTGTATTAGCTGGTGCAATTACTATATTATTGACAGATCGAAATTTAAATACAAGATTTTTTGACCCTGCTGGAGGAGGTGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez207

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez194

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATACTTTTTATTTGGATTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGTCTAGAATTAGGAATTCCAGGATCATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACTTCTCACGCTTTCATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTTTATTAATTTTAAGAAGTTTTATTAATACTGGAGTAGGAACTGGATGAACAGTTTACCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCATCCATTATAGGTGCAGTAAATTTTATTACTACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCACTATTTATTTGATCAGTATTTATTACAGCTATTTTATTATTATTATCATTACCTGTACTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGTGGTGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez178

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGATTATGGTCGGGTATATTAGGATTTTCTATGAGACTAATTATTCGTTNGGAGTTAGGTATACCAGGGAGTTTAATTGGTAATGATCAAATTTATAATAGAATGGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTTATACCTGTGATAATTGGTGGATTTGGGAATTGATTAATTCCTTTAATATTGGGGGCTCCTGATATATCATTCCCACGTATGAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTATTAATTTTAAGAGGTTTTATTAATGTTGGGGTTGGAACGGGTTGAACAGTTTACCCCCCATTATCTTTAATTTTAGGTCATGGTGGGATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCTTCTTCAATTATAGGGGCTGTTAATTTTATTACTACAATTATAAATATACGGGTTAATTTTTTTGTTATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCTTCAGGTGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez178

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez210

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATACTTTATTTTTGGAATATGAGCAGGTATACTAGGATTTTCTATAAGATTAATTATTCGACTAGAATTAGGAACACCAGGATCACTAATTATAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATGATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTCCTATTAATTTTTAGAGGATTTATTAATGTTGGAGTTGGAACAGGATGAACAGTTTATCCTCCATTATCCTTAATTTTAGGACATGGTGGAATATCTGTTGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCCGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCTTTATTTGTTTGATCAGTTTTTATTACAGCAATTTTACTTTTATTATCATTACCAGTTTTAGCTGGAGCAATCACAATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGNCCCAGCAGGNGGAGGAGATCCAANTTTATACNNNNNTTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez210

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez214

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATACTATATTTTTTATTTGGGATATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAACACCTAGTTCGTTAATTGGAAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGTGCACCTGATATATCATTCCCACGAATAAATAACATAAGATTTTGATTATTAATCCCATCTTTATTTTTATTAATTTTTAGAAGATTTATTAACATAGGTGTAGGAACAGGTTGAACAGTTTATCCTCCATTATCATTAATTCTTGGACACGGAGGTATATCAGTAGATATAAGAATTTTTGCATTACATTTAGCTGGAGCTTCATCCATTATAGGAGCAGTAAATTTTATTACTACTATTTTAAATATACGAGTAAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTATTTATTACAGCCATTTTATTATTATTATCATTACCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTCTTTGACCCTGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez214

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez211

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTCTATTTGGATTATGAGCAGGAATACTAGGATTCTCTATAAGTTTAATTATCCGTTTAGAACTTGGAACACCTGGATCATTAATTAGAAATGACCAAATTTATAACAGAATTGTTACTTCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTCTATTTATATTAATTTTCAGAGGATTTATTAACACTGGAGTTGGAACGGGCTGAACAATTTACCCACCTCTATCATTAATTTTAGGACATGGAGGAATATCTGTAGATATAGGTATTTTTTCTTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAAATTATTTATTATAGATAAAATATCACTATTTATTTGATCAGTATTTATTACAGCTATTTTACTATTATTATCTTTACCTGTTTTAGCAGGAGCAATTACTATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez211

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez176

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCTGGAATAGTTGGATTTTCAATAAGTTTAATTATTCGTTTAGAATTAGGTATNCCAGGTAGATTAATTGGTAATGATCAAATTTACAATAGGATAGTTACATCTCATGCATTTATTATAATTTTTTTTATAGTGATGCCAGTAATAATTGGGGGGTTTGGTAATTGGTTAATTCCTTTAATATTAGGGGCTCCTGATATATCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATTTATATTAATTTTAAGAGGATTTATTAATGTGGGGGTTGGGACAGGTTGAACTGTTTATCCNCCATTGTCATTAATTTTAGGACATGGGGGTATATCAGTAGATTTAGGAATTTTTTCTTTACATTTAGCTGGGGCTTCATCAATTATAGGGGCTGTTAATTTTATTACTACAATTATAAATATACGTGTTAATTTTTTTGTAATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGGGCTATTACTATACTTTTNNCTGATCGTAATTNGAATACAAGATTTTTTGACCCTTCAGGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez176

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez215

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGGTTTATGAGCAGGAATATTAGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTGGATCATTAATTCATAATGACCAAATTTATAATAGAATTATTACTTCACACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTCCCTCGATTAAATAATCTTAGATTTTGATTATTAATTCCTTCAGTATCATTATTAATTTTAAGAAGATTTATTAATACTGGTGTAGGAACAGGATGAACAGTTTACCCTCCTTTATCCTTAAACTCAAGTCATGGAGGTATATCAGTAGATATAAGAATTTTTTCTTTACATATAGCTGGAATATCATCTATTCTAGGTGCAGTAAATTTTATTTCAACAATTTTTAATATACGTGTAATTATATTTTCTATAGATAAATTACCTTTATTTATATGATCAATCTTAGTGACAGCAATTTTATTATTACTATCATTACCAGTTCTAGCAGGTGCAATTACAATATTATTAACTGATCGAAACTTAAATACAACATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles jft01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGACTAGAATTAGGAATACCAGGATCATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATCTTAAGAGGTTTTATTAATGTAGGTGTAGGTACTGGATGAACAGTATATCCACCTTTATCATTAATTTTAGGTCATGGTGGAATATCCGTAGATATAAGAATTTTTGCTTTACATTTAGCAGGAGCATCATCAATTATAGGTGCAGTAAATTTTATTACTACCATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCCTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAACACCAGATTTTTTGATCCAGCTGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 53
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez173

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAGTATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAACATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGGTCTGTTTTTATTACTGCTATTTTACTGTTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGTGGAGATCCAATTCTATATCAACATTTATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez173

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez172

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez171

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTTTATTTGGATTATGAGCAGGAATATTAGGATTTTCTATAAGAATTATTATTCGATTAGAATTAGGAACTCCAAACTCTTTAATTGAAAATGATCAAATTTATAACAGTATTGTAACTTCACACGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAATTTTATTAATATTGGTGTAGGAACTGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGACATAGTGGTATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCCGGAGCATCATCAATCATAGGGGCTATTAACTTTATTACTACTATTTTAAATATACGAGTTAATATATTTTCTATAGATAAAATATCATTATTTACTTGATCAGTATTTATTACAGCAATTTTATTATTATTATCATTACCCGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAACTTAAATACTAGATTTTTTGATCCTGCTGGTGGGGGAGACCCTATTCTTTATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez166

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATGCCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCCTTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGTATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATTATAGGGGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCACTACCTGTATTAGCAGGTGCTATTACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGACCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez166

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez168

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATTATATTTCTTATTTGGAATATGAGCTGGAATATTAGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGAATACCAGGATCTTTAATTGGTAATGACCAAATTTATAATAGAATTGTTACATCACACGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATCCCATTAATATTAGGAGCACCAGATATATCATTCCCACGAATAAACAATATAAGATTTTGATTATTAATTCCATCATTACTTTTATTAATAATAAGAGGTTTTATTAATACAGGTGTAGGAACCGGTTGAACAGTTTACCCTCCCTTATCTTTAATTTTAGGACACGGTGGTATATCTGTTGATATAGGAATTTTTGCACTACACCTTGCAGGTGCATCTTCTATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTAATATAGATAAAATATCATTATTCACTTGATCCGTTTTTATTACTGCTATTTTATTATTATTATCACTACCCGTTTTAGCAGGAGCTATTACCATACTATTAACTGATCGAAATTTAAATACAAGTTTTTTTGATCCATCTGGTGGTGGAGATCCAATNTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez168

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez169

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGTATTATATTTCTTATTTGGAATATGAGCTGGAATATTAGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGAATACCTGGATCACTAATTGGTAATGATCAAATTTATAATAGAATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTCGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTGTTCCTACTAATTCTTAGAAGTTTAATTAATGTTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATATAGGAATTTTCGCATTACATCTTGCTGGTGCATCATCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTACTATAGATAAAATATCATTATTTACTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez169

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez164

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGTATATTAGGATTTTCTATAAGATTAATTATTCGTTTGGAATTAGGGATACCAGGTAGTTTAATTGGGAATGATCAAATTTATAATAGGATAGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTAAGAGGATTTATTAATGTAGGTGTTGGTACAGGTTGAACAGTTTACCCACCATTATCTTTAATTTTAGGACATGGGGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCAGGAGCATCTTCAATTATAGGAGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTGAATTTTTTTGTTATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCTGTATTAGCAGGGGCAATTACTATATTATTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCTTCTGGAGGGGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez164

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez162

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez163

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCCATAAGTTTAATTATTCGTTTAGAGTTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTTTTATTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTTGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACCATTTTAAATATACGAGTTAAACTATTTAACATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCAGGTGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGNAGGAGATCCAATTCTATANCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez158

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATTATATTTCTTATTTGGAATATGAGCTGGAATAATAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAATACCAGGATCTTTAATTGGTAATGACCAAATTTATAATAGAATTGTCACATCACATGCTTTTATTATAATCTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAATTCCATTAATATTAGGAGCCCCAGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTAAGAAGATTTATTAATATAGGTGTAGGAACAGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCACGGTGGTATATCAGTAGATATAGGAATTTTTGCTTTACATCTTGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTATTTAATTTAGATAAAATACCATTATTCAATTGATCTGTTTTTATTACTGCTATTCTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGTTTTTTTGACCCATCTGGTGGAGGTGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez159

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATACTTTATTTTATTTTCGGTTTATGAGCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGACTAGAATTAGGAACACCTGGATCGTTAATTGGAAATGACCAAATTTACAATAGCTTAGTTACTTCACACGCTTTCGTCATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCCGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATCCCATCATTATTTTTATTAACATTAAGAAATTTTATTAATCTAGGAGTAGGAACAGGTTGAACAGTTTATCCACCATTATCTTTAACTTTAGGTCATAGAGGAATATCAGTAGATATAAGAATTTTTGCATTACATTTAGCAGGAGCATCATCCATTATAGGAGCTATTAATTTTATTACAACTATTTTAAATATACGAATTAAACTTTTTAATATAGATAAAATATCATTATTTATTTGATCAGTATTTATTACTGCTATTTTACTTTTATTATCATTACCAATTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCATCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez152

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez161

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGTATACCAGGATCATTAATTGGTAATGATCAAATTTATAACAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGTGGATTTGGAAATTGATTAATTCCCTTAATATTGGGATCCCCAGATATATCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATCATTATTAATTATTAGAGGTTTTATTAATATTGGTATAGGTACTGGTTGAACAGTTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGGATATCAGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGTATATCTTCAATTATAGGTGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTATAATAGATAAAATATCTTTATTTATTTGATCAGTATTTATTACAGCTATTCTATTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez161

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez160

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGGTTTATGAGCTGGAATACTAGGATTTTCTATAAGAATAATTATTCGATTAGAATTAGGAACACCAGGCTCATTAATTGGTAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCCCGAATAAATAATATAAGATTTTGATTACTAATTCCTTCACTATTTTTATTAATTTTTAGAGGATTTATTAATATAGGTGTTGGAACAGGTTGAACAGTATATCCTCCTTTATCATTAATTTTAGGACATGGAGGTATATCTGTAGATATAGGAATTTTTGCTCTACATTTAGCAGGAGCATCATCAATTATAGGAGCAGTAAACTTTATTACTACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCATTATTTATTTGATCTGTATTAATTACAGCAATTTTATTACTTTTATCTTTACCGGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAACTTAAACACTAGATTTTTTGATCCAGCAGGTGGGGGTGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez160

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez155

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTCGGTTTATGAGCTAGAATATTAGGATTTTCTATAAGTTTGATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATATTAGAATTGTTACATCTCATTCCTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCTTTATTCTTGTTAATATTTAGGGGATTTATTAATACTGGAGTAGGGACAGGATGAACTGTATACCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTGGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAACTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACCGCCATTTTACTATTACTATCATTACCTGTATTAGCTGGTGCCATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATACCAACATTTATTTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez155

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez149

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTATGAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATATCCTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAGTATTTAGAGGATTTATTAACACTGGTGTAGGAACAGGATGAACAGTATATCCACCATTATCTCTAATTTTAGGTCATGGAGGAATATCAGTAGATATAGGAATTTTTGCTTTACACTTAGCTGGGGCTTCCTCAATCATAGGAGCAGTTAATTTTATTACTACTATTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTCGATCCAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez149

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez150

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAATAAGATTAATTATTCGATTAGAATTAGGAATACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGGGGATTTGGAAATTGATTAATTCCCTTAATATTAGGAGCACCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATCTTTATTAATTATAAGAGGTTTTATTAATACTGGTGTAGGAACTGGATGAACAGTATACCCCCCTTTATCACTAACTTTAGGACATAGTGGTATATCAGTAGATATAGGAATTTTTGCATTACATTTAGCTGGAGCATCATCTATTATAGGAGCAATTAATTTTATTACTACTATCTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCCTTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTACTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGTGGAGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez150

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez148

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATATTTCTTATTTGGAATATGATCCGGAACATTAGGTTTCTCAATAAGATTAATTATTCGATTAGAATTAGGTACACCAGGATCACTAATTGGTAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTAATACCGGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCTTTAATATTAGGATCCCCAGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCCTCATTATTTTTACTAATTTTAAGAAGTTTTATTAATACAGGAGTAGGTACTGGTTGGACTGTATACCCTCCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATCTTCGCCCTACATTTAGCAGGAACATCATCTATTATAGGTGCAGTAAACTTTATTACTACTATTTTAAATTTACGAGTTAATTTATTTATTATAGATAAAATATCACTATTTACTTGATCAGTATTTATCACCGCCATTCTACTATTACTATCACTCCCTGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCCTCCGGAGGAGGAGATCCAATTTTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez148

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez143

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATACTTTTTATTTGGTTTATGAGCTGGAATATTAGGTTTTTCTATAAGATTAATTATTCGCTTAGAACTTGGTTCACCAGGTTCATTAATTAATAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGGAATTGATTAATTCCATTAATATTAGGTGCACCAGATATATCTTTCCCTCGAATAAATAATATAAGATTCTGATTATTAATTCCATCCTTATTTTTACTAATTTTAAGAGGTTTTATTAATACAGGAGTAGGAACCGGATGAACAGTTTACCCACCATTGTCCTTAATTTTAGGTCATGGAGGAATATCTGTAGATATAGGAATTTTTGCCTTACATTTAGCTGGAACATCATCTATTATAGGTGCAGTAAATTTTATTACTACTATTTTAAATATACGAATTAATTTATTTATTATAGATAAAATATCTTTATTTATTTGATCAGTATTTATTACAGCTATTTTATTACTTTTATCTCTACCCGTATTAGCAGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCATCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez143

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez131

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATACTTCCTATTCGGAATATGGGCTGGTATATTAGGATTTTCTATAAGAATAATTATTCGATTAGAATTAGGAATACCAGGATCATTAATTAAAAATGATCAAATCTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGTGCTCCTGATATATCCTTCCCCCGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTCTATTAATTTTAAGAAGATTTATTAATACTGGAGTTGGAACTGGATGAACAGTATACCCTCCTCTATCTTTAATTTTAGGTCATAGAGGAATATCAGTAGATATAAGAATTTTTGCCCTACATCTAGCAGGAATATCTTCAATTATAGGAGCTGTAAATTTCATTACTACTATCTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCACTATTTATTTGATCAGTTTTTATTACAGCTATTTTACTCCTTTTATCATTACCTGTTTTAGCAGGAGCAATCACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez131

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez142

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGAATATGAGCTGGAATATTAGGATTCTCTATAAGATTAATTATCCGATTAGAATTAGGTATACCTGGTTCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTGGTTCCTTTAATATTAGGAGCACCAGATATATCTTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTCTAAATTTATTAATTTTAAGAAATTTTATTAATACCGGTGTAGGAACAGGATGAACCGTATATCCACCTTTATCACTAATTTTAGGTCATGGAGGTATATCAGTAGATATAGGAATTTTCGCTTTACATTTAGCAGGAGCATCATCTATTATAGGAGCAGTAAACTTTATTACTACTATTTTAAATATACGAACTAATTTATTTTCTATAGACAAAATATCATTATTTATTTGATCAGTTTTCATTACAGCAATTTTATTATTATTATCTTTACCTGTATTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATTTAAACACCAGATTTTTTGATCCTGCAGGTGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez125

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTATGTTTGGTATTTGATCTGGAATATTTGGATTTTCATTAAGATTAATTATTCGTTTAGAATTGGGAATACCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGTGTTGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCAGTTGATATATCTTTCCCACGAATAAATAATATGAGATTTTGATTATTAATTCCATCTATTTTTTTATTAATTATAAGAAGATTTATTAATGTTGGTGTAGGTACTGGATGAACTGTTTATCCTCCATTATCTTTAATTTTGGGTCATGGGGGTATATCAGTTGATATAGGAATTTTTTCTTTACATTTGGCTGGTGCTTCATCTATTATAGGAGCTGTTAATTTTATTACAACAATTCTTAATATACGTACAAATTTATTTATAATAGATAAAATTTCTTTATTTGTTTGATCAGTATTTATTACAGTTATTTTATTATTATTATCTTTACCTGTATTGGCAGGGGCTATTACTATATTATTAACAGATCGTAATATTAATACTAGATTTTTTGATCCTTCAGGTGGGGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez125

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez129

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGATTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGTTTAGAACTAGGAATACCAGGATCATTAATTGAAAATGATCAAATTTATAATAGTATTGTTACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATGTTAGGAACCCCAGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCATATTAATATTTAGAAGATTTATTAATATTGGAGTAGGAACTGGATGAACAGTATATCCACCTTTATCATTAATTTTAGGTCATAGAGGTATATCAGTAGATATAGGTATTTTTGCATTACATTTAGCTGGAGCATCATCAATTATAGGAGCAGTAAATTTCATTACTACTATTCTAAATATACGAATTAATCTTTTTATTATAGATAAAATATCATTATTTATTTGATCAATTTTAATTACAGCTATTTTATTACTATTATCATTACCAGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez129

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez138

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGATTATGAGCTGGAATATTAGGATTTTCTATAAGATTAATTATTCGAATAGAATTAGGAACAACTAGATCATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGTTTCGGAAATTGATTAATCCCTTTAATATTAGGAGCTCCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTTAGAAGATTTATTAATATAGGTGTTGGAACAGGTTGAACAGTATATCCACCTTTATCATTAACTTTAGGTCATAGTGGTATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGAGCATCATCAATTATAGGTGCTGTAAATTTTATTACAACAATTCTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCTTTATTTATCTGATCAGTATTCATTACAGCCATTTTACTATTATTATCATTACCAGTTCTTGCAGGAGCAATTACAATATTATTAACTGATCGAAATATAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez138

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez127

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTCATATTTGGAATATGATCAGGAATATTAGGATTCTCAATAAGATTAATCATTCGTTTAGAATTAGGAACACCTGGTTCATTAATTGGTAATGACCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGACTATTAATTCCTTCTTTATTTTTATTAGTATTTAGAGGATTTATTAATACAGGAGTAGGGACAGGATGAACAGTATATCCCCCTTTATCCTTAATTTTAGGCCATGGTGGAATATCGGTAGATATAGGTATTTTTGCATTACATTTAGCAGGAGCATCCTCAATTATAGGGGCAATTAATTTTATTACTACAGTTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCACTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTACTATCTTTACCTGTTTTAGCAGGTGCTATTACAATATTATTAACTGACCGAAATCTAAATACAAGTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez127

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez105

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGAATATGAGCAGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGTATACCTGGATCATTAATTGGTAATGATCAAATTTACAATAGAATTGTTACATCACATGCTTTCATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCACCCGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTATTTTTTTATTAGTATTTAGAGGATTTATTAATACAGGTGTTGGAACAGGATGAACAGTTTATCCTCCTTTATCCCTAATTTTAGGTCATGGAGGTATATCAGTAGATATGGGAATTTTTGCTTTACATTTAGCAGGAGCTTCTTCAATCATAGGAGCTATTAATTTTATTACAACAATTTTAAATATACGAGTAAAATTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCAATTCTTCTTTTATTATCATTACCAGTATTAGCAGGAGCAATTACCATATTATTAACTGATCGAAATTTAAATACAAGTTTTTTTGATCCAGCTGGTGGAGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez105

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez89

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez106

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTCATATTTGGATTATGAGCTGGAATATTAGGATTCTCTATAAGATTAATTATTCGATTAGAATTAGGAATACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCCTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTACTACTATTTAGAGGTTTTATTAATGTTGGAGTAGGAACAGGTTGAACAGTATATCCTCCATTATCTTTAATTTTAGGTCATGGTGGTATATCAGTAGATATAGGAATTTTTGCTTTACATCTTGCTGGTGCATCTTCAATTATAGGAGCAATTAATTTTATCTCTACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCATTATTCACTTGATCAGTTTTTATTACTGCTATTCTTCTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGTGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez110

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTCGGATTATGAGCTGGAATGTTAGGATTCTCTATAAGATTAATTATTCGATTAGAACTAGGAACAACAAGATCATTAATTAGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGGTTTGGAAATTGATTAATCCCTTTAATATTAGGTGCACCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTATATTAACATTTAGAAGATTTATCAATGTAGGGGTAGGAACTGGATGAACTGTATATCCACCATTATCATTAATTTTAGGTCATGGTGGTATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTAAATTTATTTTCTATAGATAAAATATCTTTATTTATTTGATCAGTTTTTATTACCGCTATTTTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACAATATTACTAACTGATCGAAATTTAAATACAAGTTTTTTTGACCCAGCAGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez110

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez113

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATACTTTATTTTTTATTTGGTTTTTGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAACACCAGGATCATTGATTAATAATGATCAAATTTATAATAGTATTGTAACCTCACATGCTTTTATTATAATTTTCTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGTGCACCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCATCTTTATTTTTATTAATTTTTAGAAGATTCATTAATTTAGGAGTAGGAACAGGATGAACAGTATATCCTCCTTTATCATTAATTTTAGGTCATGGAGGTATATCAGTAGATATAAGAATTTTTGCTTTACATTTAGCAGGTATATCATCTATTATAGGAGCTATAAATTTTATTACAACTATTATAAATATGCGAATTAAATTATTTAATATAGATAAAATATCATTATTTGTTTGATCTATTTTTATTACAACTATTTTATTATTATTATCATTACCTGTATTGGCAGGTGCAATTACAATATTATTAACTGATCGAAATCTAAATACAAGATTTTTTGATCCTGCTGGTGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez109

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATACTATATTTTATATTTGGTTTATGAGCAGGAATATTGGGATTCTCTATAAGTTTAATTATTCGTTTAGAATTAGGAACACCTGGATCATTAATTAGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCTGACATATCATTCCCCCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAACATTCAGAAGATTTATTAATGTTGGAGTAGGAACTGGATGAACAGTTTATCCACCATTATCTTTAATTATTGGACACGGAGGTATATCTGTTGATATAGGAATTTTTGCTTTACATCTAGCAGGTGCATCCTCTATTATAGGAGCAATTAATTTTATTACAACTATTCTTAATATACGAGTAAATCTATTTATTATAGATAAAATATCTTTATTTATTTGATCTGTTTTCATTACTGCTATTCTATTATTATTATCTTTACCTGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGTGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft14

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft27

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft15

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Whitfield17

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGATTATGAGCAGGAATATTAGGATTTTCATTAAGATTAATTATTCGATTAGAATTAGGTACACCTAGATCACTAATTGGAAATGACCAAATTTATAACAGAATTGTAACCTCTCATGCATTTATTATAATTTTCTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGAATAAATAATATAAGTTTTTGATTATTAATTCCATCTTTAACTTTATTAATTATAAGAGGTTTCATTAATACTGGAGTAGGAACAGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATATAGGAATTTTTTCACTTCATTTAGCTGGAGCTTCATCAATTATAGGAGCCGTAAATTTTATTACAACAATTATAAATATA---CGAGTAAATTTATTCATTATAGATAAAATATCATTATTTATTTGATCTGTATTTATTACAGCAATTTTACTATTATTATCTTTACCTGTACTAGCAGGTGCAATTACTATATTATTAACTGATCGAAACTTAAATACTAGATTCTTTGATCCTGCAGGAGGAGGTGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield17

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez221

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez204

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGATTATGATCTGGAATATTAGGATTTTCAATAAGATTAATTATCCGATTAGAATTAGGAATACCTGGATCATTAATTGGTAATGATCAAATTTATAATAGTATTGTAACTTCACATGCTTTCATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTCTTTTAATTTTTAGAAGATTTATTAATATTGGAGTAGGAACAGGTTGAACAGTTTATCCACCTTTATCATTAATTTTAGGTCATAGAGGAATATCAGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGTATATCTTCAATTATAGGAGCAGTTAATTTTATTACTACTATTATAAATATACGAATTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTACTTTTATTACAGCTATTTTATTATTACTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez204

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez183

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TGAGCTGGAATTTTAGGTTTCTCATTAAGATTAATTATTCGTTTAGAATTAGGTACACCAGGATCACTTATTAATAATGATCAAATTTATAATAGTATTGTTACTTCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTCTAATATTGGGTGCACCAGATATATCTTTCCCACGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTTCTTTTAATTTTAAGTAGTTTTATTAATATTGGAGTAGGAACTGGTTGAACTGTTTACCCCCCCCTATCACTAATATTAAGACACAGTGGAATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCATCAATCATAGGGGCAGTAAATTTCATTACTACAATTTTAAACATACGAACAAATATATTTACTATAGACAAAATATCTTTATTTGTTTGATCAGTTTTTATTACAGCCATTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAACTTAAATACTAGATTTTTTGATCCTGCTGGAGGTGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez183

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez212

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTCATATTCGGATTATGATCTGGTATATTAGGATTTTCTATAAGATTAATTATCCGATTAGAATTAGGGATACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCCTCATTATTCTTATTAATTTTTAGAAGATTCATTAACGTTGGTGTAGGAACTGGATGAACAGTCTACCCTCCTTTATCATTAATTATAGGCCATAGAGGAATATCAGTAGATATAAGAATTTTTGCATTACATTTAGCAGGGGCGTCATCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATCTTTTTTTAATAGATAAAATATCTTTATTTACTTGATCAGTATTTATTACAGCTATTTTATTATTATTATCATTACCTGTTTTGGCAGGAGCAATTACTATACTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez212

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez184

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAAGATTACCAGGATTATACATTAATAATGATCAAATTTACAATAGTATTATTACTTCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATACCTTCTTTATTTTTATTAATTTTAAGAAGATTTATTAATAATGGGGTAGGAACAGGTTGAACAGTATACCCTCCTTTATCATTAAATTTAAGACATAGGGGGATATCAGTAGATATAAGAATTTTTGCATTACATTTAGCAGGGGCATCTTCTATTATAGGAGCTGTAAATTTCATTACGACAATTTTAAATATACGAACCAATTTATTTATTATAGATAAATTATCTTTATTTATTTGATCAATTTTTATTACAGCAATTTTATTACTTATATCTTTACCTGTATTAGCTGGTGCAATCACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCTGGAGGAGGGGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez184

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez191

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATGGGCCNGGAATATTGGGATTCTCAATAAGACTAATTATTCGATTAGAATTAGGTATACCGGGAACACTAATTGGAAATGACCAAATTTATAATAGAATTGTCACATCACATGCTTTTATTATAATCTTTTTTATAGTAATACCTGTAATAATTGGCGGATTCGGCAATTGATTAATCCCCCTTATATTAGGATCACCAGATATATCATTTCCACGAATAAATAATATAAGTTTCTGATTATTAATTCCCTCTTTATTTTTATTAATTTTAAGTAATTTTATTAACACAGGAGTTGGAACTGGTTGAACTGTCTATCCCCCATTATCATTAATTTTAGGCCATGGAGGTATATCTGTAGATATAGGAATTTTTGCCCTACACTTAGCAGGAATATCATCTATTATAGGTGCAGTAAATTTTATTACTACCATTTTAAATATACGAATTAATTTATTTATTATAGATAAAATATCATTATTTACTTGATCAGTATTTATTACTGCCATTCTATTATTATTATCACTCCCTGTACTAGCAGGTGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGGGGNGATCCNATCCTATACCAACATTNNTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez191

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez182

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTCTATTTGGTTTATGAGCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTGGGAATACCAGGTTCATTAATTGGAAATGATCAAATTTATAATAGTATTGTTACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGTTTCGGAAACTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTAATTCCCTCATTATTTTTATTAATCTTTAGAAGATTTATTAATGTTGGAGTTGGAACAGGTTGAACTGTATATCCTCCTTTATCATTAATTTTAGGTCATGGGGGTATATCAGTAGATATAGGAATTTTTTCTTTACACTTAGCTGGAGCTTCATCAATTATAGGAGCAGTAAATTTCATTACTACAATTTTAAATATACGAATTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACAGCTATTCTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACCATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGAGGTGGGGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez182

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez192

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGTTTATGAGCAGGAATACTAGGATTTTCAATAAGATTAATTATCCGATTAGAATTAGGCTTACCAGGATCAATAATTAAAAATGATCAAATTTATAATAGTATTGTTACATCTCATGCCTTCATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGGGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCACCAGATATATCCTTCCCACGAATAAATAACATAAGATTTTGATTATTAATTCCCTCATTATTTTTATTAATTTTAAGAAGTTTTATTAATACAGGAGTAGGAACTGGATGAACTGTATACCCTCCTTTATCATTAATTACTAGACATGGGGGTATATCAGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGTGCATCTTCAATTATAGGGGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTTAACCTCTTTTCAATAGACAAAATATCATTATTTATTTGATCAGTATTTATCACTGCTATTTTATTATTACTTTCTCTTCCTGTTTTAGCTGGGGCTATCACAATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez192

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez179

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGTTTATGGGCAGGTATATTAGGATTTTCTATAAGATTAATTATTCGTTTAGAATTAGGCATACCTGGAAGATTAATTTGTAATGATCAGATTTATAATAGTATAGTTACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTGTGATGATTGGGGGATTTGGGAATTGATTAATTCCTTTAATATTAGGGTCCCCTGATATATCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTTTATTAGTTTTAAGAGGGTTTATTAATACTGGGGTTGGGACCGGGTGAACAGTTTATCCTCCCTTGTCTTTAATTTTAGGTCATGGTGGTATGTCTGTTGATTTAGGAATTTTTTCATTACATTTGGCGGGGGCTTCTTCAATTATAGGGGCTGTAAATTTTATTACTACAATTTTAAATATACGGGTGAATTTTTTTGTTATAGATAAAATGTCTTTGTTTTCTTGATCTGTATTTATTACAGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACAATATTGTTAACTGATCGAAATTTAAATACTAGGTTTTTTGATCCTTCAGGAGGNGGGGATCCAATTTTANATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez179

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez188

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles JFT25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen41

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen49

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen46

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez267

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen45

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGTTTATGATCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCACATGCTTTCATTATAATTTTTTTTATAGTTATACCTGTAATGATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTCTTTTAATTTTTAGAAGATTTATTAATATTGGAGTAGGAACAGGTTGAACAGTTTACCCACCTTTATCATTAATTTTAGGTCATAGAGGAATATCAGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGTATATCATCAATTATAGGAGCAGTAAACTTTATTACTACTATTTTAAATATACGAGTCAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTACTTTTATTACAGCTATTTTATTATTATTATCACTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGTGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen30

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTTTATTTGGTTTATGATCAGGAATAGCGGGATTTTCAATAAGTTTAATTATTCGATTAGAACTAGGAACCCCCGGTTCATTAATCAAAAACGATCAAATTTACAATAGAATTGTTACTTCCCACGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAATTCCCTTAATATTAGGTGCCCCAGATATATCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTAATCCCTTCATTATTTTTATTAATTTTTAGAAGTTTTATCAACATAGGAGTAGGAACTGGATGGACCGTTTACCCACCATTATCTTTAATTTTAGGACATAGAGGTATATCAGTTGATATAAGAATTTTTTCATTACATCTAGCCGGAGCTTCATCAATTATAGGGGCCATTAATTTTATTACAACAATCTTAAATATACGAACTCATTTATTCATTATAGATAAAATATCTTTATTTACATGATCAGTATTTATCACAGCCATTCTTTTACTGTTATCTTTACCAGTTCTTGCAGGAGCTATCACAATATTATTAACAGACCGAAATTTAAATACAAGTTTTTTTGATCCCGCAGGTGGAGGGGACCCAATTCTTTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen36

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTCAATAAGATTAATTATTCGTTTAGAATTAGGAATACCAGGATCATTAATTGGGAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTAATTCCTTCATTATTTTTATTAATTTTTAGTGGATTTATTAATACAGGTGTTGGTACTGGATGAACAGTATATCCTCCATTATCATTAATTCTTGGCCATGGTGGCATATCAGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCTGTAAATTTTATTACCACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCATTACCTGTATTAGCTGGGGCTATTACTATACTACTAACTGATCGAAATTTAAATACAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen27

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATACTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGTATACCAGGTTCATTAATTATAAATGATCAAATTTATAATAGTATTGTAACTTCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAATCCCCTTAATATTAGGATCCCCCGACATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTTTATTAATTATAAGAAGTTTTATTAATACAGGTGTAGGAACAGGATGAACAGTATACCCTCCTTTATCATTAATTAGAGGACATGGAGGTTTATCAGTAGATATAAGAATTTTTGCTTTACACTTAGCAGGAGCATCTTCAATTATAGGGGCAGTAAATTTTATCACCACAATTTTAAATATACGAGTTAATTTATTCGTTATAGATAAAATATCTTTATTTATTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCCTTACCTGTATTAGCAGGAGCAATTACTATACTTTTAACAGACCGAAATTTAAATACAACATTTTTTGATCCAGCTGGAGGAGGNGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen27

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen48

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGTATATGATCAGGAATAGTTGGATTCTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTAATTATTTAATTGGAAATGATCAAATTNATAATAGTATTGTTACTTCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTCGGAAATTGATTAATTCCTTTAATACTTGGAGCACCTNATGTATCATTCCCTCGAATAAATAATATAAGATTTTGATCACTAATTCCNTCATTATTTTTATTAATTTTAAGTAGATTTATTAATATAGGAGTTGGAACTGGTTGAACAGTTTATCCTCCTTTATCTTTAATTTTANGACATGGAGGTATATCTGGAGATATAAGAATTTNTTCTTTACATTTAGCAGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTATAAATATACGTGTAAAATTATTTATTATAGACAAAATATCACTATTCACATGATCAGTTTTTATTACAGCTANNCTACTATTATTATCTTTACCTGTTCTTGCTGGTGCAATTACTATANTATTAACAGACCGCAACTTAAATACAAGATTTTTTGATCCNGCTGGTGGTGGAGANCCAATTTTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen48

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen15

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGACTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCACGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAGTATTTAGAGGTTTTATTAATACTGGAGTAGGAACAGGATGAACAGTATATCCTCCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCCTCAATTATAGGGGCAGTTAATTTTATTACAACTATTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCCTTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGCGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen43

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATACTTTATATTCGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGACTAGAATTAGGTATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCACGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATATTTAGAGGTTTCATTAATACTGGTGTAGGAACAGGATGAACAGTATATCCTCCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAGTTAATTTTATTACAACTATTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCCTTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez272

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCCGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATGATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCATTATTCTTATTAATATTTAGAGGATTTATTAATACTGGTGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAGGAATTTTTGCCTTACATTTAGCTGGGGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCACTACCTGTATTAGCAGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez272

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez271

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez270

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NTATTATATTTCCTATTTGGAATATGAGCTGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAACTAGGAACACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCACTATTTTTATTAATTTTTAGAGGTTTTATTAACATAGGTGTAGGAACAGGTTGAACAGTTTATCCCCCATTATCATTAAATTTAGGACATAGAGGTATATCAGTAGATATAGGAATTTTTGCTTTACATCTTGCTGGAGCATCATCTATTATAGGGGCAATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTATTTAATATAGATAAAATATCATTATTCATTTGATCAGTTTTTATTACAGCAATTCTATTATTATTATCATTACCTGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACAAGTTTTTTTGATCCATCTGGTGGAGGTGACCCAATCTTATACCAACACCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez269

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez240

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez268

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez253

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTATATATTTTATATTTGGTTTGTGATCTGGGATGGTAGGATTTTCAATAAGTTTAATTATTCGTTTAGAATTAGGTAATCCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAGTTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGGGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATGAGTTTTTGATTATTAGTTCCTTCAATTTTAATATTAATTTTAAGAAGATTTATTAATGTAGGAGTAGGAACTGGATGAACGGTGTATCCTCCATTGTCTTTAATTTTAGGTCATGGTGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCAGGAGCTTCATCTATTATAGGTGCAGTTAATTTTATTACTACAATTTTAAATATGCGAGTTATGTTATTTTTAATGGATAAAATATCATTATTTTCTTGATCTGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATATTAATACAAGATTTTTTGATCCTTCAGGTGGTGGAGATCCAATTTTATATCAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez253

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez251

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATATTATACTTCATATTTGGATTATGAGCTGGAATATTAGGATTCTCTATAAGATTAATTATTCGATTAGAATTAGGTATACCAGGATCATTAATTGGAAATGACCAAATTTATAATAGAATCGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATCCCATTAATATTAGGAGCACCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTACTATTATTTAGAGGTTTTATTAATGTTGGAGTAGGGACAGGATGAACAGTCTACCCTCCATTATCATTAATTTTAGGCCATGGTGGTATATCAGTAGATATAGGAATTTTTGCATTACATCTTGCTGGTGCATCTTCAATTATAGGAGCAATTAATTTCATTTCTACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCATTATTCACTTGATCAGTTTTTATTACTGCAATTCTTTTACTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTCTTTGATCCAGCCGGTGGAGGAGACCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez251

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez250

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGGATTATGGGCAGGAATATTAGGTTTTTCTATAAGATTAATTATTCGGCTAGAATTAGGANCACCAGGATCATTAATTGGTAATGACCAAATTTATAATAGAATTGTTACATCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCTGATATATCATTCCCCCGAATAAATAATATAAGATTTTGATTACTAATTCCATCATTATTTTTACTATTATTTAGAAGATTTATTAATATAGGAGTTGGTACAGGATGAACTGTTTACCCACCTTTATCATTAATTTTAGGCCATGGTGGAATATCAGTTGATATAAGAATTTTTGCTTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACCACAATTTTAAATATACGAGTTAATATATTTATTATAGATAAAATATCTTTGTTTACTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTACTAGCTGGAGCAATCACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTGCTGGTGGGGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez250

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez180

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez154

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTATATTTTTTATTTGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGTATACCAGGATCATTAATTGGTAATGATCAAATTTATAACAGAATTGTTACTTCACATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTCTAATACTTGGAGCCCCAGATATATCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTCTTTCTTTATTAATTTTAAGAGGTTTTATTAATGTTGGTGTTGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGGGGAATATCAGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGTGCATCATCAATTATAGGAGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTAAATTTATTTATTATAGATAAAATATCTCTATTTATCTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCCGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGTGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez154

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez153

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez14 error

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTTTATTTGGATTATGAGCTGGAATGTTAGGATTTTCTATAAGATTAATTATTCGTTTAGAACTAGGAATACCAGGATCATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCCGTAATAATTGGTGGATTTGGAAATTGATTAATCCCTTTAATATTAGGAGCACCTGATATATCATTCCCACGAATAAACAATATAAGATTCTGATTATTAATTCCATCATTATTTTTATTAATTTTCAGAGGATTTATTAATGTTGGTGTAGGAACAGGATGAACAGTTTATCCTCCCTTATCATTAATTCTAGGTCATGGAGGTATATCAGTAGATATAGGAATTTTTGCATTACATTTAGCTGGAGCATCATCTATCATAGGTGCAGTAAATTTCATCACTACTATCTTAAATATACGAGTTAATTTATTTATTATAGACAAAATATCACTATTTATTTGATCTGTTTTCATTACAGCTATTTTACTACTTCTTTCTCTTCCTGTTTTAGCTGGAGCAATTACCATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez14 error

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez235

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATACTATATTTTATATTTGGATTATGAGCTGGTATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAATACCTGGTTCATTAATTAATAATGATCAAATTTATAATAGAATCGTAACTTCCCATGCATTTATTATGATTTTTTTTATAGTTATACCTGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGACATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTAAGAAGATTAATTAATGTAGGTGTTGGAACTGGATGAACAGTTTATCCACCATTATCACTAATTTTAGGGCATGGAGGTATATCTGTAGATATAGGAATTTTTTCCTTACATTTAGCAGGAGCATCCTCAATTATAGGGGCCGTAAATTTTATTACTACAATTATAAATATACGAGTAAACTTATTCATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTACTATTACTATCTTTACCAGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGTGACCCAATCTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez235

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft33

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 87
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen29

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATACTTTATTTTCGGATTATGAGCTGGAATATTAGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACAACAAGATCATTAATTAATAATGATCAAATTTATAATAGTATTGTTACCTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCACTATTATTATTAATTTTAAGAGGTTTTATTAATATAGGTGTAGGTACAGGATGAACAGTCTATCCACCTTTATCATTAATTTTAGGACATGGAGGTATATCAGTAGATATAGGAATTTTTGCATTACATCTAGCAGGAGCCTCCTCCATTATAGGTGCAGTAAATTTTATTACTACTATTTTAAATATACGTGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTATTCATCACAGCAATTTTATTATTACTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTAACCGATCGAAATTTAAATACAAGATTTTTTGATCCCGCTGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen29

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen33

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCCGGAATAGTGGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAACACCAGGATCAATAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCACATGCATTTATTATAATTTTCTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGAGCTCCAGATATATCATTCCCTCGAATAAATAACATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAGATTTATTAATATTGGGGTTGGAACAGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGACATGGAGGTATATCAGTAGATATAAGAATTTTTGCTTTACATTTGGCTGGAGCATCTTCTATTATAGGTGCAATTAATTTTATTACAACAATTATAAATATACGAGTTAATCTTTTTTTAATAGATAAAATATGTTTATTTATTTGATCAGTATTTATTACAGCTATTTTATTATTATTATCATTACCAGTTTTGGCTGGAGCAATTACTATATTATTAACTGATCGAAACTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGATCCAATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen33

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen34

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATACTTTTTATTTGGTTTATGAGCTGGAATACTAGGATTTTCAATAAGATTTATTATTCGATTAGAACTTGGAATACCAGGATCATTAATTAATAATGACCAAATTTATAATAGTATTGTAACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGATTTGGTAATTGATTAATCCCATTAATATTAGGTGCCCCCGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTATTCCCATCCTTATTTTTATTAATATTTAGTAGATTTATTAATATAGGTGTAGGAACAGGTTGAACAGTTTACCCCCCTTTATCATTAATTTTAAGTCATGGAGGTATATCAGTAGATATAAGAATTTTTTCTTTACATTTAGCTGGTGCATCATCCATTATAGGAGCAGTAAATTTTATCACAACTATTTTAAATATACGAATTAATTTATTTACTATAGATAAAATATCCTTATTCACTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCCGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTCTTTGATCCAGCTGGTGGAGGAGACCCAATTTTATACCANCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Janzen19

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTACTAATATTTAGGAGATTCATTAATACTGGAGTAGGTACAGGATGAACTGTATATCCTCCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCATTGCCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen19

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez92

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft19

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft42

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Whitfield07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez219

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GAATATTAGGATTTTCTATAAGAATTATTATTCGATTAGAATTAGGAACTCCAAACTCTTTAATTAGTAATGATCAAATTTATAACAGTATTGTAACTTCACACGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCCTTAATATTAGGAGCACCTGATATATCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAATTTTATTAATGTAGGAGTAGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGGCATAGTGGTATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCCGGAGCATCATCAATCATAGGAGCTATTAATTTTATTACTACTATTTTAAATATACGAGTCAATATATTTTCTATAGATAAAATATCATTATTTACTTGATCAGTATTTATTACCGCGATTTTATTATTATTATCATTGCCTGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez219

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez202

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGTTTATGAGCTGGAATATTAGGATTTTCAATAAGAATAATTATTCGATTAGAATTAGGTACACCAGGATCATTAATTAATAATGATCAAATTTATAATAGAATTGTTACATCACACGCTTTTATTATAATTTTTTTTATAGTAATACCCGTAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAGCACCCGATATATCATTCCCACGAATAAACAATATAAGATTTTGATTATTAATTCCATCTTTATTTTTATTAATTTTTAGAAGATTTATTAATACAGGAGTAGGAACAGGTTGAACTGTTTACCCACCATTATCATTAATATTAGGACACAGAGGTATATCAGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGTATATCTTCTATTATAGGAGCAGTAAATTTTATTACTACTGTATTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTATTTTCATTACAGCAATCTTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACTATACTATTGACAGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGTGGAGGAGATCCAATTCTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez202

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez177

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGGTTATGGTCTGGAATAGTTGGATTTTCTATAAGTTTAATTATTCGTTTGGAATTAGGAATACCTGGTAGTTTAATTGGTAATGATCAAATTTATAATAGAATAGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATGATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCATCATTAACATTATTAATTTTAAGAGGATTTATTAATATAGGGGTAGGAACTGGTTGAACAGTATATCCACCATTATCTTTAATTTTAGGTCATGGTGGTATATCAGTTGATATAGGAATTTTTTCTTTACATTTAGCAGGAGCATCTTCAATTATAGGAGCAGTTAATTTTATTACAACAATTATTAATATACGAGTTAATTTTTTTATTATAGATAAAATTTCTTTATTTTCTTGATCTGTTTTTATTACAGCTATTTTATTGTTATTATCATTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCATCTGGAGGTGGGGATCCAATTTTATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez177

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez203

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATCCTTTATTTTTTATTTGGTTTATGAGCTGGAATTCTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTGGATCATTAATTAATAATGATCAAATTTATAATAGAATTGTAACTTCACATGCATTCATCATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGCTTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTATTAATAACACTTAGAAGATTTATTAATATAGGAGTAGGAACAGGTTGAACAGTTTATCCACCATTATCATTAACTTTAGGTCATAGTGGGATAGCAGTAGATATAAGAATTTTTGCTTTACATTTAGCAGGTGCATCATCAATTATAGGAGCAATTAATTTTATTACTACTATTTTAAATATACGAATTAATTTATTTATTATAGATAAAATAACCTTATTTATTTGATCTATTTTCATTACAGCTATTTTATTACTTCTATCACTACCTGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez203

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez190

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTATTTGGAATATGAGCCGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAACTTGGAATACCAGGATCACTAATTGGAAATGATCAAATTTACAATAGTATTGTTACATCACATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGATCACCTGATATATCCTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCCTTAACTTTATTAATTTTAAGAAATTTTATTAACACTGGTGTAGGAACCGGATGAACTGTATATCCACCACTATCATTAATTTCAAGACATGGAGGAATATCAGTAGATATAAGAATTTTTGCACTACATTTAGCAGGAGCATCATCCATTATAGGAGCAGTAAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTATTATTGATAAAATATCATTATTTACTTGATCAGTATTTATTACAGCAATTCTTTTATTATTATCATTACCCGTATTAGCAGGTGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGANTCTTTGATCCAGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez190

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez217

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTTTATTTGGAATATGATCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAACCCCTGGATCATTAATCGGAAATGATCAAATTTATAATAGTATTGTTACATCACATGCATTTATTATAATTTTTTTTATAGTAATACCCGTAATAATTGGAGGATTTGGAAATTGATTAATCCCCTTAATACTAGGAGCACCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAATTTTATTAATTTAGGTGTAGGAACTGGGTGAACTGTTTACCCCCCTTTATCATTAATTCTAGGACATGGAGGAATATCAATTGATCTAAGAATCTTTTCCTTACATTTAGCAGGAGCATCCTCTATTATAGGGGCAGTAAACTTTATTACCACAATCTTAAATATACGAGTTAAATTATTTATTATAGATAAAATTTCATTATTTATTTGATCAGTCTTTATTACAGCTATCTTATTATTATTATCATTACCAGTTCTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAACACTAGTTTTTTTGATCCTTCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez217

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez198

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGTTTATGATCTGGAATATTAGGATTTTCTCTAAGATTAATTATTCGGTTAGAATTAGGAATTCCAGGTTCATTAATTAGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATGTCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTTAGAAGATTTATTAATACTGGTGTAGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAATTTTAGGACATGGAGGGATATCAGTAGATATAAGAATTTTTGCATTACATTTAGCTGGAGCATCTTCAATTATAGGTGCAATTAATTTTATTACTACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCTGGTGGGGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez198

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez201

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTTGGTTTATGAGCTGGAATATTAGGATTTTCAATAAGAATAATTATTCGATTAGAATTAGGAACACCAGGATCACTAATTAATAATGATCAAATTTATAACAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATGGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATACTAGGAGCACCTGATATATCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTATTTTTATTAATATTTAGAAGATTTATTAATATAGGTGTAGGAACAGGTTGAACAGTATATCCTCCATTATCATTAAATTTAGGACATAGAGGAATATCGGTAGATATAAGAATTTTTTCTTTACATTTAGCAGGTATATCCTCCATTATAGGAGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTCATTTGATCTGTTTTTATTACAGCAATCTTATTGTTATTATCATTACCTGTATTAGCAGGTGCAATTACTATACTTTTAACAGACCGAAACTTAAATACAAGATTTTTTGATCCATCTGGTGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez201

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez199

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGTTTATGATCTGGAATATTAGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACACCAGGATCATTAATTAATAATGATCAAATTTATAACAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGAATAATTCCATTAATATTAGGATCTCCAGATATATCCTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCACTATTTTTATTAATTTTTAGAAATTTTATTAATTTAGGAGTTGGAACCGGTTGAACAGTTTATCCTCCTTTATCTTTAATTTCAAGGCATAGAGGTATATCAGTTGATATAAGAATTTTTGCATTACATTTAGCAGGAGCATCATCTATTATAGGAGCAGTAAATTTTATCACCACTATTATAAATATACGAATTAATCTATTTATTATAGACAAAATATCACTTTTTACTTGATCAATTTTAATTACAGCTATCTTATTACTTTTATCTTTACCTATTCTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCTGGAGGGGGGGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez199

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez205

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTCGGATTATGATCCGGTATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAATACCTGGATCATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACATCACACGCTTTTATTATAATTTTTTTCATAGTTATACCCGTAATAATTGGAGGATTTGGAAATTGATTAATCCCGTTAATATTAGGTTCACCAGATATATCCTTCCCACGAATAAATAACATAAGTTTTTGACTATTAATCCCTTCTTTATTTTTATTAATTTTTAGAAGATTTATTAATACAGGAGTTGGAACTGGATGAACAGTTTATCCTCCTTTATCTTTAATTATAAGACATGGAGGGATATCAGTAGATATAAGTATCTTTGCTTTACATTTAGCAGGGGCATCATCAATCATAGGAGCAATTAATTTTATTACTACTATCTTGAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATCTGATCCGTATTTATTACAGCTATTTTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCGGCTGGTGGAGGGGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez205

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez181

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATATTTGGCTTATGAGCCGGAATATTAGGATTTTCAATAAGATTAATTATTCGAATAGAATTAGGAATACCAGGATCATTAATCAAAAATGATCAAATTTACAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTAATATTAGGAGCACCAGATATATCTTTCCCACGAATGAATAATATAAGATTTTGACTACTAATTCCTTCATTAATATTATTAATTTTAAGAAGATTTATTAATACAGGAGTTGGTACTGGATGAACAGTATACCCTCCTTTATCTTTAATTATAGGTCATGGAGGTATATCAGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGAGCATCATCAATTATAGGAGCAGTAAATTTTATTACTACAATTATAAATATACGAACAAATTTATTTATTATAGACAAAATATCATTATTTACTTGATCAATCTTTATTACTGCAATTTTACTTTTATTATCATTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCAGGAGGAGGTGATCCTATCCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez181

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez200

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATACTTTATTTTTTATTTGGTTTATGAGCAGGAATTTTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGTTCACCAGGTTCATTAATAAATAATGATCAAATTTATAATAGAATTGTTACATCACATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCTTTCCCACGAATAAATAATATAAGATTTTGACTATTAATTCCATCTTTATTTTTATTATTATTTAGAAGATTTATCAATATAGGAGTAGGAACAGGCTGAACAGTTTATCCACCATTATCATTAATTTTAGGGCATGGAGGAATATCAGTAGATATAAGAATTTTCGCTTTACATTTAGCTGGTGCTTCATCAATTATAGGAGCAGTAAATTTCATTACTACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACAGCCATTTTATTATTATTATCATTACCTGTATTAGCAGGGGCAATCACTATACTTTTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGGGGTGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez185

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATACTATATTTCATATTTGGATTATGATCAGGAATATTAGGCTTCTCAATAAGTTTAATTATTCGACTAGAATTAGGAAATCCAGGATCATTAATTAACAATGACCAAATTTATAATAGTATTGTAACTTCACATGCTTTCATTATAATTTTTTTTATAGTAATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTCCCACGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTTTATTAACTTTTAGAAGATTTATTAATGTAGGTGTAGGAACTGGATGAACAGTTTATCCCCCCTTATCCCTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTGCTCTACATTTAGCTGGAGCATCTTCCATTATAGGTGCAGTAAATTTTATTACTACTATTATAAATATACGAATTAATTTATTTATTATTGATAAAATATCATTATTTATTTGATCAGTTTTTATCACAGCAATTTTACTATTATTATCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAACACAAGATTTTTTGACCCAGCTGGTGGTGGAGATCCTATTCTTTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez185

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez175

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGCTTGTGGTCAGGAATAGTGGGATTTTCAATAAGTTTAATTATTCGTTTAGAATTAGGTATGCCAGGAAGATTAATTGGGAATGATCAAATTTATAATAGAATAGTTACATCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATATCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATTTATGTTAATTTTAAGAGGATTTATTAATGTGGGGGTTGGTACAGGTTGAACAGTTTATCCACCATTATCTTTAATTTTAGGACATGGGGGGATATCAGTGGATTTAGGAATTTTTTCTTTACATTTGGCTGGGGCTTCATCAATTATAGGGGCTGTTAATTTTATTACTACAATTATAAATATACGTGTTAATTTTTTTGTGATAGATAAAATGTCTTTATTTTCTTGATCTGTTTATATTACGGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATACTTTTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTGCAGGGGGAGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez175

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez128

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTTTATTTGGATTATGAGCTGGAATATTAGGATTTTCTATAAGAATTATTATTCGATTAGAATTAGGAACTCCAAATTCTTTAATTGGTAATGATCAAATTTATAATAGTATTGTAACTTCACACGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTCAGGAATTTTATTAATGTTGGTGTAGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGACATAGTGGCATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACTACTATCTTAAATATACGAGTTAATATATTTTCAATAGATAAAATATCATTATTTACTTGATCAGTATTTATTACAGCAATTTTATTATTATTATCATTACCCGTATTAGCTGGTGCAATTACAATATTATTAACTGATCGAAACTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGATCCCATTCTTTACCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez128

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez130

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTTTATTTGGTTTGTGAGCTGGTATATTAGGATTTTCAATAAGATTAATTATTCGACTAGAATTAGGAACTCCTGGATCATTAATTAATAATGACCAAATTTATAATAGTATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGTGCTCCTGATATATCATTCCCACGAATAAATAATATAAGTTTTTGATTATTAATCCCCTCATTATTTTTATTAATTTTTAGAAGATTTATTAATATAGGAGTCGGAACAGGATGAACAGTTTATCCTCCTCTATCTTTAATTTTAAGACATAGAGGAATATCAGTAGATATAAGAATTTTTGCTTTACATTTAGCTGGAATATCATCAATTATAGGAGCAATAAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTATTATAGATAAAATATCACTTTTCATTTGATCTGTTTTTATTACAGCTATTTTATTATTACTATCATTACCAGTTTTAGCAGGTGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez130

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez147

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATATTTCTTATTTGGAATATGATCCGGAATATTAGGTTTCTCAATAAGATTAATTATTCGATTAGAATTAGGTACACCAAGATCACTAATTGGTAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTAATACCGGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCTTTAATATTAGGATCCCCAGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCCTCATTATTTTTATTAATTTTAAGAAGTTTTATTAATACAGGTGTAGGAACTGGTTGAACTGTATACCCCCCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATCTTCGCCCTACACTTAGCAGGAGCATCATCTATTATAGGTGCAATAAACTTTATTACTACTATTTTAAATTTACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTACTTGATCAGTATTTATCACCGCTATTCTACTATTATTATCACTTCCTGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCCTCTGGAGGGGGAGATCCAATTTTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez147

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez132

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 99 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATACTATATTTTATTTTTGGATTATGAGCTGGTATATTAGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACAACAGGATCATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCCGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCTTCACTACTATTATTAATTTTAAGAGGGTTTATTAATACAGGTGTAGGAACAGGATGAACAGTTTACCCTCCTTTATCCTTAATTTTAGGTCATGGAGGTATATCAGTAGATATAGGAATTTTTGCTCTACATCTAGCAGGAACATCCTCTATTATAGGTGCCGTCAATTTTATTACCACTATTTTAAATATACGTGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCATTACCAGTTTTAGCAGGAGCAATTACTATACTATTAACAGATCGAAACTTAAATACAAGATTTTTTGATCCCGCCGGTGGAGGTGATCCAATTTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez132

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 81
Specimens with Barcodes: 99
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez121

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATACTTCATTTTTGGAATATGAGCAGGAATAATAGGATTTTCACTAAGTTTAATTATCCGATTAGAACTAGGAACACCAGGATCTCTAATTGGAAATGATCAAATTTATAATAGAATCGTTACATCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTTTAATGATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATCTTTATTAATATTAAGAAATTTTATTAATATAGGTGTAGGAACAGGATGAACAATTTATCCTCCATTATCATTAATTTTTAGACATGGAGGAATATCAATTGATTTAAGAATTTTTGCCCTACATTTAGCAGGAGCTTCATCAATTATAGGAGCAGTAAATTTTATTACAACAATTATAAATATACGAGTTAAAATATTAAATATAGATAAAATATCATTATTTATTTGATCAATTTTAATCACAGCTATTCTTCTACTTTTATCATTACCAATTTTAGCAGGTGCTATTACCATATTATTAACTGATCGAAACATAAACACAAGATTTTTTGACCCAGCAGGAGGTGGAGACCCTATTCTTTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez121

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez122

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGTTTATGAGCTGGAATAATAGGATTTTCAATAAGATTAATTATTCGATTAGAATTAGGAAATCCTGGATCAATAATTAGAAATGACCAAATTTATAATAGTATCGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGTGCACCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTACTAATTCCATCTTTATTACTTTTAATATTTAGAAGATTAATTAATATTGGAGTAGGAACAGGTTGAACAGTATACCCTCCCTTATCATTAATCTTAAGTCATGGAGGTATATCAGTAGATATAGGAATTTTTGCCCTACATTTAGCTGGAGCATCTTCTATTATAGGAGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCCGTTTTTATTACAGCTATTTTACTATTATTATCACTACCAGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGGGATCCTATTTTATACCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez124

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGAATATGATCAGGAATTTTAGGATTTTCTTTAAGATTAATTATTCGATTAGAATTAGGAACACCTAATTACTTAATTGGAAATGATCAAATTTACAATAGTATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTAAGAAGATTTATTAATACAGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATTTAAGAATTTTTTCTTTACATCTTGCTGGGGCATCTTCAATTATAGGAGCAATTAACTTTATTACCACAATTTTAAATATACGAGTTAATTTTTTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCAATTCTTTTATTACTTTCATTACCTGTATTAGCTGGAGCAATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCAGGAGGAGGAGANCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez124

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez123

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATACTTTTTATTTGGATTATGATCTGGAATATTAGGATTTTCTTTAAGATTAATTATTCGTTTAGAATTAGGAATACCAGGTTCATTAATTAGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATTTTTAGAAGATTTATTAATACCGGTGTAGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAATTTTAGGACATGGAGGAATATCAGTAGATATAAGAATTTTCGCATTACATTTAGCTGGAGCATCATCAATTATAGGTGCAATTAATTTTATTACTACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCAATTACTATATTATTAACTGATCGAAACTTAAATACTAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez146

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATATTTTTTATTTGGAATATGATCCGGAATATTAGGATTTTCAATAAGATTAATTATTCGGTTAGAACTCGGAATACCAGGATCACTAATTGGAAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTCATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGATCACCTGATATATCTTTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATCTTTATTAATTTTAAGAAATTTTATTAATACTGGAGTAGGAACTGGATGAACTGTTTATCCACCACTATCATTAATTTCAAGACATGGGGGAATATCAGTAGATATAAGAATTTTTGCTCTACATTTAGCAGGAGCATCATCCATTATAGGAGCAGTAAATTTTATTACTACTATCTTAAATATACGAATTAATTTATTTATTATTGATAAAATATCTTTATTTACTTGATCAGTATTTATTACAGCAATTCTTTTATTATTATCATTACCCGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTCTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez146

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez117

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATTTTCAATAAGATTAATTATTCGATTAGAACTAGGAACACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCAGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATTTTTAGAAGATTTATTAACACTGGAGTAGGAACAGGATGAACAGTTTACCCTCCATTATCATTAATTCTAGGTCATGGAGGAATATCAGTAGACATAAGAATTTTCGCTTTACACTTGGCTGGAGCATCTTCTATTATAGGTGCAGTTAATTTTATTACAACAATTATAAATATACGAATTAATCTATTTTTAATAGATAAAATATCTTTATTTATTTGATCAGTATTTATTACAGCTATTTTATTATTATTATCATTACCAGTATTGGCTGGTGCAATTACTATATTATTGACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez117

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez99

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTCATATTTGGATTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGTATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCTTCATTATCTTTATTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACAGTATATCCGCCTTTATCTTTAATCTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCTCTACATTTAGCAGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTATAAATATACGGATTAATTTATTTATTATAGATAAAATATCTTTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTACTACTATCATTACCTGTATTAGCAGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCCGGTGGAGGAGATCCAATTCTTTATCAACACTTATTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez99

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez112

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATACTTTATNTTATTTTTGGATTATGNGCTGGAATTTTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGACATGTCATTCCCACGAATAAATAATATAAGATTTTGACTATTAATCCCTTCATTATTTTTATTAATATTTAGAAGATTTATTAATATAGGAGTAGGAACAGGATGAACAGTATATCCACCTTTATCATTAATTTTAGGACATGGAGGTATATCAGTAGATATAAGAATTTTTGCATTACATTTGGCTGGAGCATCATCAATTATAGGTGCAATTAATTTTATTACTACAATTTTAAACATACGTGTTAATTTATTTAATATAGATAAAATATCACTATTTATTTGATCAGTTTTTATTACAGCCATTTTATTGTTATTATCACTACCTGTTCTAGCTGGAGCAATCACCATATTATTAACTGATCGAAATTTAAATACAAGATTCTTTGANCCTGCTGGNGGAGGNGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez112

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez114

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATACTTTTTATTTGGAATATGAGCTGGAATACTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAATACCAGGTTCATTAATTGGAAATGATCAAATTTATAATAGTATTGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGGGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCCCCTGATATATCATTCCCACGAATAAACAATATAAGATTTTGATTACTAATTCCATCTTTATTTATATTAATTTTTAGAAGTTTTATTAATATTGGGGTAGGAACAGGATGAACAGTTTACCCACCTTTATCATTAATTTTAGGGCATGGAGGAATATCAGTAGATATAAGAATTTTTGCCTTACATTTAGCAGGGGCATCATCTATTATAGGGGCAGTAAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTCTTATAGATAAAATATCTTTATTTATCTGATCTGTTTTTATTACAGCTATTTTATTACTTTTATCTCTACCTGTTCTAGCTGGTGCTATTACTATATTACTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez116

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAATAATTGGATTTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCTGGATCATTAATTATAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGANTTGGAAATTGATTAATTCCACTAATGCTTGGAGCCCCAGACATATCATTCCCACGAATAAATAATATAAGATTTTGATTATTAATCCCCTCACTATTCCTTCTAATATTTAGAAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCTCCATTATCCTTAATTTCTAGGCATGGAGGAATATCTGTTGATATAAGAATTTTTGCTTTACATTTAGCAGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTATAAATATACGTGTAAATTTATTTATTATAGATAAAATATCCTTATTTATTTGATCTGTATTTATTACAGCAATTTTATTATTATTATCATTACCAGTTTTAGCGGGTGCAATTACCATACTTTTAACTGATCGAAATTTAAATACAAGATTTTTTGACCCTTCAGGAGGAGGAGATCCAATTTTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez116

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez108

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez115

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGCCTATGAGCTGGAATACTAGGATTCTCAATAAGTTTAATTATTCGCTTAGAATTAGGTACACCAGGTTCTTTAATTATAAATGATCAAATTTATAATAGTATTGTTACATCACATGCTTTTATCATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTCGGAAACTGACTAATCCCTTTAATATTAGGGGCTCCTGACATATCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTAATTCCTTCATTACTTTTATTAATTTTTAGAAGATTTATTAATGTTGGAGTTGGGACTGGTTGAACAGTTTACCCCCCATTATCATTAATTTCTAGACATGGAGGTATATCTGTAGACATAAGAATTTTCTCTCTACATTTAGCTGGCATATCCTCAATTATAGGAGCAATAAATTTTATTACAACTATCCTAAATATACGAGTTAACTTTTTTGTTATAGATAAAATATCTCTATTTATTTGATCAGTTTTTATTACCACTATTTTATTATTATTATCACTCCCCGTTTTAGCAGGAGCAATCACCATACTACTAACTGATCGAAATCTAAATACCAGATTTTTTGACCCCTCAGGAGGGGGAGATCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez57

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTAGAAATGACCAAATTTATAATAGGATTGTCACATCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTGTTAATTCCTTCACTATTCTTATTAATATCCAGAGGATTTATCAATAATGGAGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATCATAGGGGCAATTAACTTCATTACAACTATTTTAAATATACGAGTTAAATTATTTATAATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez57

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez53

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTANNNNAGNNNNGTNNNNNCNNATGCNNNNNNTNNNNNTTTCTTTNNNGTTATNNNNNNNNNNNNTGGAGNNNTTGGANNCTGANTAATTCCNTTAATATTAGNNGCTNNTNNNATATCNTTCCNNNNAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTCTATTAATATTTAGAGGATTTATTAACACTGGAGTAGGAACAGGATGAACAGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCATTACACTTAGCAGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGGGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTATTTTTATTACTACTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGTGGTGATCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez53

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez51

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 76 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTCGGTTTATGAGCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGACTAGAATTAGGTATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTTGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTTCCACGAATAAACAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTATTAATATTTAGAGGTTTCATTAATACTGGTGTAGGAACAGGATGAACAGTATATCCTCCATTATCTCTAATTTTAGGTCATGGAGGAATATCTGTAGATATAGGAATTTTTGCTTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAGTTAATTTTATTACAACTATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTATTTGATCTATTTTTATTACTACAATTTTATTATTATTATCCTTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez54

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGAGCTGGAATATTAGGATTTTCCATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTAGAAATGACCAAATTTATAACAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATAATAATTGGGGGATTTGGAAACTGATTAATTCCTTTAATACTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTCTGATTATTAATTCCTTCATTATTTCTATTAATATTAAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATACCCACCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATCAATTTTATTACAACTATTTTAAATATACGAGTTAAAATATTTATTATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCCATTTTATTATTATTATCATTACCTGTATTAGCAGGTGCTATTACAATATTATTAACTGATCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez54

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez36

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGTTTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGTTTCGGAAACTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCCCGAATAAATAATATAAGATTTTGACTATTAATTCCTTCATTATTTTTATTAATATTTAGGGGATTCATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCTTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATCACAACTATTCTAAATATACGAGTTAAAATATTTATTATAGATAAAATATCATTATTTACCTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATTACTATACTATTAACTGACCGAAATTTAAATACAAGATTTTTTGACCCAGCTGGTGGAGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez40

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATATTCGGTTTATGAGCTGGAATATTAGGATTTTCCATAAGTTTAATTATTCGTTTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAGATTTATAATAGAATCGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAACTGATTAATTCCTTTAATACTAGGAGCCCCTGATATATCATTCCCCCGAATAAATAATATAAGATTTTGACTATTAATTCCTTCATTATTTTTACTAATATTTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCACCATTATCTTTAATTTTAGGACATAGAGGAATATCAGTAGATATAAGAATTTTTGCCTTACATTTAGCCGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACCATTTTAAATATACGAGTTAAATTATTTATCATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCCGTATTAGCCGGTGCTATTACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGGGACCCCATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez38

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTAATATTAATATTTAGAAGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATACCCACCATTATCTTTAATTCTAGGACATGGAGGAATGTCCGTAGACATAAGAATTTTTGCCTTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTTTTTATAATAGATAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAATACAAGATTTTTTGATCCAGCTGGTGGAGGTGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez35

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAACTAGGAATACCTGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTAATTCCCTCGTTATTTTTATTAATATTTAGAAGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTGTATCCTCCATTATCTTTAATTTTAGGACATGGAGGAATATCTGTAGATATAAGAATTTTTGCCCTACATTTAGCTGGAGCATCCTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAATTATTTATTATAGACAAAATATCATTATTTATTTGATCTGTTTTCATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCCATTACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez33

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGATTATGATCCGGAATATTAGGATTTTCAATAAGTCTAATTATTCGATTAGAAATAGGAACACCAGGATCATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCTGATATATCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTATTATTTAGAGGATTTATTAATATTGGTGTAGGAACAGGTTGAACAGTTTATCCTCCATTATCATTAATTTTAGGACATGGTGGTATATCAGTAGATATAAGAATTTTTGCATTACATCTTGCTGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTATTATAGATAAAATATCATTATTTACTTGATCAGTTTTTATTACTGCTATTCTTTTATTATTATCTCTACCTGTACTAGCTGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez39

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGATCATTAATTGGAAATGACCAAATTTATAATAGAATTGTTACATCTCATGCCTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATATCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTCTTATTAATAATTAGAGGATTTATTAATACTGGAGTAGGAACAGGATGAACTGTATATCCGCCATTATCTTTAATTCTAGGACATGGAGGAATATCCGTAGATATAAGAATTTTTGCCCTACATTTAGCTGGAGCATCTTCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAGTTAAACTATTTATAATAGACAAAATATCATTATTTATTTGATCTGTTTTTATTACTGCTATTTTACTATTATTATCATTACCTGTATTAGCTGGTGCTATCACAATATTATTAACTGACCGAAATTTAAACACAAGATTTTTTGACCCAGCTGGTGGTGGAGATCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez266

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen18

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen37

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Janzen25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft31

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles jft11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apanteles Rodriguez167

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGATTATGATCTGGAATATTAGGATTTTCTATAAGATTAATTATCCGTTTAGAATTAGGAACAACTGGATCATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCCGTAATAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCTGATATATCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTATTTTTATTAATATTTAGTAGATTTATTAACATTGGTGTCGGTACAGGTTGAACTGTATATCCTCCCCTATCATTAATTTTAGGCCATGGAGGAATATCAGTAGATATAGGAATTTTCGCTTTACATCTAGCAGGAGCATCATCAATTATAGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATATATTTATAATAGATAAATTATCATTATTTACTTGATCAGTTTTTATTACAGCAATTTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apanteles Rodriguez167

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!