Archips argyrospila — Details

Fruittree Leafroller learn more about names for this taxon

Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Comprehensive Description

General Description

Learn more about this article

The adult is highly variable in wing pattern. Most commonly it is heavily mottled with brown to orange. The darkest markings are normally in the basal patch, slanted median band, and postmedian blotch that can extend to the anal angle. Distinctive bright yellow to cream squares are often present on the costa between the darker bands. The hindwings are typically dark grey with a lighter fringe. Males have a costal fold that extends to or barely past the basal patch. The larva is green with scattered pale warts and fine setae. The prothoracic shield is dirty green with variable amounts of black or dark brown laterally and the head is shiny dark or light brown. The larva can not be reliably separated from Choristoneura rosaceana and is closely similar to several other common tortricid species. (Chapman & Lienk 1971; Mackay 1962)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Distribution

Learn more about this article

Throughout Canada from the southern Northwest Territories and most of the US and into Central America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

National Distribution

Learn more about this article

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat

Learn more about this article

Most habitats that have deciduous trees and shrubs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trophic Strategy

Trophic Strategy

Learn more about this article

The larvae feed on the foliage and fruit of a wide variety of deciduous trees and shrubs and occasionally forbs. It can be a serious pest in apple, pear, cherry, plum, peach, apricot, and citrus orchards. (Chapman & Lienk 1971; Kruse & Sperling 2001; Razowski 1977; Freeman 1958; Forbes 1923)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Cyclicity

Cyclicity

Learn more about this article

Adults are active from late June to late July in Alberta, April to July elsewhere. (Chapman & Lienk 1971; Razowski 1977; Forbes 1923)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life Cycle

Life Cycle

Learn more about this article

The eggs are laid in oval batches of 20-100 eggs on the twigs or bark of the host tree. The first instar larvae often spin strands of silk and under ideal wind conditions can disperse to other areas. Larvae construct leaf-rolls where they emerge from to feed and when disturbed the larvae either retreat or suspend down on a line of silk. Populations are highly cyclical and can this species can become a pest in orchards. (Chapman & Lienk 1971; Razowski 1977; Kruse & Sperling 2001)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Archips argyrospila

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0256-06|AF308931|Archips argyrospila| CGAAAATGACTTTATTCAACAAATCATAAAGATATTGGTACATTATATTTTATTTTTGGTATTTGATCTGGTATAATTGGAACTTCACTA---AGATTACTAATTCGAGCCGAATTGGGAAATCCAGGATCATTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATA---TTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCATCTATTATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCTCATAGAGGAAGATCAGTAGATTTA---GCAATTTTTTCCTTACATTTAGCTGGGATTTCTTCAATTTTAGGAGCTGTTAATTTTATTACAACTATTATTAATATACGACCTAATAATATAGCATTAGACCAAATACCATTATTTGTCTGAGCTGTGGGTATTACAGCTTTATTACTTTTATTATCTTTACCAGTATTAGCCGGT---GCTATTACTATATTACTAACAGATCGAAATTTAAATACATCATTCTTTGATCCAGCTGGAGGTGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGACACCCCGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCTCACATTATTTCTCAAGAAAGAGGAAAAAAA---GAAACTTTTGGATGTCTTGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTGTAGTATGAGCTCATCATATATTTACAGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Archips argyrospila

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 98
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

Conservation Status

Learn more about this article

Not of concern, widespread and occasionally a pest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

National NatureServe Conservation Status

Learn more about this article

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

NatureServe Conservation Status

Learn more about this article

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Archips argyrospila

Learn more about this article

The Fruit-Tree Leafroller Moth (Archips argyrospila) is a moth of the Tortricidae family. It is found in most of the United States and southern Canada.

The length of the forewings is 6-10.2 mm for males and 8.5-11.7 mm for females. Adults have a variable forewing colour consisting of combination of reddish brown, dark brown and tan. Adults are on wing from mid May to July in one generation per year.

The larvae feed on a wide range of plants and are considered a pest on apples and pears.[3] Recorded host plants include: Medicago, Malus, Prunus, Taxodium distichum, Phaseolus, Vaccinium, Betula, Acer negundo, Aesculus, Ceanothus, Cercocarpus, Citrus, Quercus, Eriodictyon, Vitis, Crataegus, Carya, Gleditsia triacanthos, Humulus, Syringa, Avena, Allium, Maclura pomifera, Pyrus, Rheum, Sassafras and Juglans species. First instar larvae bore into the buds of their host plant. Later instars roll or tie leaves together or tie them to fruit. They feed on the leaves, flowers, buds or fruits of the host plant. Pupation takes place within the larval shelter.[4]

References

  1. ^ tortricidae.com
  2. ^ mothphotographersgroup
  3. ^ Bug Guide
  4. ^ Archips argyrospila - Fact Sheet


This Archipini-related article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!