Molecular Biology and Genetics
Molecular Biology
Barcode data: Phalonidia contractana
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGCACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGCTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGTGGATTTGGTAACTGATTAGTACCTCTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCCTCTATTATATTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCTGGAACTGGATGAACAGTTTACCCCCCACTTTCATCCAATATTGCCCATAGAGGTAGATCTGTTGATCTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACAACTATTATTAATATGCGGCCTAATAATATATCACTAGATCAAATACCTTTATTTGTTTGGGCAGTTGGAATTACAGCTTTATTACTTTTACTTTCATTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACATCATTTTTTGATCCTGCTGGGGGAGGAGATCCAATTTTATATCAACACTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Phalonidia contractana
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Phalonidia contractana
Phalonidia contractana is a moth of the Tortricidae family. It is found in southern Europe (including Spain, southern France and Italy), Dalmatia, Macedonia, Hungary, Romania, Bulgaria, Greece, Ukraine, southern Russia (Sarepta), Urask, Turkey, Kuldscha, Afghanistan, Kashmir and Lebanon.
Larvae have been recorded on Artemisia, Anthemis, Cichorium, Lactuca, Inula viscose and Inula graveolens.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
