Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Exorista fasciata is endoparasitoid of larva of Zygaena trifolii

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Zygaena trifolii

Animal / parasitoid / endoparasitoid
larva of Phryxe magnicornis is endoparasitoid of larva of Zygaena trifolii

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Zygaena trifolii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATATTTGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTGGGAAACCCCGGATCTTTAATTGGGGATGATCAAATTTATAATACAATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGTGCTCCAGATATAGCTTTCCCACGAATAAATAACATAAGTTTTTGATTATTACCACCTTCATTAATACTATTAATCTCAAGAAGAATTGTAGAAAGAGGAGCAGGGACAGGTTGAACAGTTTACCCACCTTTATCATCTAATATTGCACATGGTGGAAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATCTTAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGACCTTATGGTATAAGTTTTGATCAAATACCATTATTTGTTTGATCTGTGGGTATTACTGCATTACTTTTATTACTCTCATTACCAGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGGGGAGGAGATCCAATTCTTTATCAATATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Zygaena trifolii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Zygaena trifolii

The Five-spot Burnet (Zygaena trifolii) is a moth in the family Zygaenidae. It is found from North Africa, through the western Mediterranean, southern Great Britain and central Europe to Ukraine. It is not found in Scandinavia, the central Alps and Italy.[1]

Larva

The wingspan is 28–33 mm. Adults are on wing from the mid June to the beginning of August in one generation per year.

The larvae feed on the leaves of Lotus uliginosus and Lotus corniculatus. The species overwinters in the larval stage and may overwinter twice.

Subspecies[edit]

  • Zygaena trifolii trifolii
  • Zygaena trifolii barcelonensis Reiss, 1922
  • Zygaena trifolii caerulescens Oberthur, 1910
  • Zygaena trifolii decreta Verity, 1925
  • Zygaena trifolii duponcheliana Oberthur, 1910
  • Zygaena trifolii espunnica Reiss, 1936
  • Zygaena trifolii hibera Verity, 1925
  • Zygaena trifolii lusitaniaemixta Verity, 1930
  • Zygaena trifolii olbiana Oberthur, 1910
  • Zygaena trifolii palustrella Verity, 1925
  • Zygaena trifolii palustris Oberthur, 1896
  • Zygaena trifolii pusilla Oberthur, 1910
  • Zygaena trifolii subsyracusia Verity, 1925
  • Zygaena trifolii syracusia Zeller, 1847 (the Channel Islands and the coastal regions of north-western France from Loire-Atlantique to Côtes-d’Armor and Ille-et-Villaine)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!