Ecology
Associations
Animal / parasitoid / endoparasitoid
larva of Bessa parallela is endoparasitoid of larva of Cilix glaucata
larva of Bessa parallela is endoparasitoid of larva of Cilix glaucata
© BioImages
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Cilix glaucata
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAACTGATTAGTACCTTTAATATTAGGAGCACCAGACATGGCATTCCCACGAATAAATAATATAAGATTTTGACTACTTCCCCCATCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACTGTATATCCCCCCCTTTCATCTAATATTGCCCATGGTGGTAGATCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATGCGATTAAATAATATAATATTTGACCAAATACCTTTATTTGTATGGGCTGTAGGAATCACAGCCTTTCTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATACTACTAACAGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGTGGGGGAGACCCTATTTTATATCAACATTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Cilix glaucata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Cilix glaucata
The Chinese Character (Cilix glaucata) is a moth of the family Drepanidae.[1] It is found in Europe and North Africa.
The wingspan is 18–22 mm. The moth flies from April to August depending on the location.
The larvae feed on Rubus, Crataegus and Prunus.
References
- ^ "Chinese Character at UKmoths". Ukmoths.org.uk. http://ukmoths.org.uk/show.php?id=2150. Retrieved 2011-12-19.
 | Wikimedia Commons has media related to: Cilix glaucata |
 | This article on a moth of the Drepanidae family is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
