Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Bessa parallela is endoparasitoid of larva of Cilix glaucata

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cilix glaucata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAACTGATTAGTACCTTTAATATTAGGAGCACCAGACATGGCATTCCCACGAATAAATAATATAAGATTTTGACTACTTCCCCCATCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACTGTATATCCCCCCCTTTCATCTAATATTGCCCATGGTGGTAGATCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATGCGATTAAATAATATAATATTTGACCAAATACCTTTATTTGTATGGGCTGTAGGAATCACAGCCTTTCTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATACTACTAACAGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGTGGGGGAGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cilix glaucata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cilix glaucata

The Chinese Character (Cilix glaucata) is a moth of the family Drepanidae.[1] It is found in Europe and North Africa.

The wingspan is 18–22 mm. The moth flies from April to August depending on the location.

The larvae feed on Rubus, Crataegus and Prunus.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!