Overview

Comprehensive Description

Taxon images

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, by Lewis L. Deitz and Matthew S. Wallace

Partner Web Site: Consortium of mx users.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Neotropical and Nearctic regions; also introduced to the Australian region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, by Lewis L. Deitz and Matthew S. Wallace

Partner Web Site: Consortium of mx users.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aconophora n. sp. CPL-2004

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTTTTACCTCCTTCTTTAATTTTATTGATCTCAAGATCAATAATTGAATTAGGAGCTGGTACAGGATGAACTATCTATCCTCCATTATCATTAAATATTGCTCATTCAGGAGCTAATGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCTATCTTGGGAGCCATCAATTTTATTACAACAATTATAAATATAAAATGTAAAGGTCAAAATTTTGATCGACTACCTCTTTTTGTATGATCAGTTTTAATTACAGCAATTTTATTACTTTTATCTTTACCAGTTCTTGCTGGAGCAATCACTATATTGCTAACAGACCGAAATCTAAATACTTCATTTTTTGATCCTTCAGGAGGAGGAGATCCTATCTTATACCAGCATTTATTTTGATTTTTTGGTCACCCTGAAGTCTATATTTTAATCCTTCCAGGATTCGGGTTAATTTCACACATTATTATTATAGATAGAGGTAAAAATGAATCTTTTGGTTATATTGGAATAATTTATGCTATAATTTCTATTGGTATTTTAGGATTTGTAGTTTGAGCTCATCATATATTTACAGTAGGAATAGATGTTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aconophora n. sp. CPL-2004

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 10
Specimens with Sequences: 9
Specimens with Barcodes: 8
Species: 6
Species With Barcodes: 6
Public Records: 9
Public Species: 6
Public BINs: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!