Articles on this page are available in 1 other language: Spanish (11) (learn more)

Molecular Biology and Genetics

Molecular Biology

Barcode data: Umbonia crassicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATTAATTTTAAGATCTTTAATAGAAATAGGAGCAGGGACAGGTTGAACAATTTATCCCCCCTTATCAAGAAATACCGCTCATTCAGGACCAAGAGTAGATTTAGTAATTTTTTCATTACATTTAGCAGGTATATCTTCAATTTTAGGTTCAATTAACTTAATCTCAACAATTTTAAATATACGATGCACAGGTTTAAAATTAGAACAAATACCTTTATTAGTTTGATCTATTATATTAACAGCAGTTTTACTAATTAGATCATTACCAGTCCTTGCTGGAGCAATTACTATATTACTTACTGATCGTAATATTAATACATCTTTTTTTGACCCATCCGGTGGAGGAGACCCAATTTTGTACCAACACTTATTTTGATTCTTTGGACACCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGTGTTATTTCACATATTATTATGCAAGAAAGAGGAAAAAATGAATCATTTGGTTATATTGGTATAATATACGCAATAATTTCAATTGGAATTCTTGGGTTTATCGTTTGAGCTCATCATATATTTACAGTTGGGTTAGATGTAGATACTCGAGCTTACTTTACATCTGCTACAATAATTATTGCAGTTCCTACTGGTATTAAAATTTTTAGTTGATTAGCTACTATACATGGATCT---TGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Umbonia crassicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Umbonia crassicornis

Umbonia crassicornis is a common and widespread member of the family Membracidae, and one of numerous species colloquially referred to as thorn bugs. The body length of the adult is approximately 10 millimetres (0.39 in). This is a variable species as to size, color and structure, particularly the pronotal horn of males (which is more angled posteriorly than the females' and often somewhat expanded apically). This tall, essentially perpendicular thorn-like pronotum discourages birds and other predators from eating it, if only by mistakenly confusing it with a thorn. Typically, the adult is green or yellow with reddish lines and brownish markings. The range of this species is from Northern South America all the way to Mexico and Florida. Three other species in this genus occur elsewhere in the United States. Its preferred hosts are ornamental and fruit trees of subtropical regions.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!