Physical Description

Type Information

Syntype for Illinoia macrosiphum Wilson, 1912
Catalog Number: USNM 399804.003
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: ; Immature
Preparation: Slide section
Collector(s): H. Wilson
Year Collected: 1911
Locality: Corvallis, Benton, Oregon, United States
  • Syntype: Wilson, H. F. 1912. Aphid notes from Oregon. Canadian Entomologist. 44: 153-159, 191-194.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Illinoia macrosiphum Wilson, 1912
Catalog Number: USNM 399804.002
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;;; Adult; Wings Apterous
Preparation: Slide section
Collector(s): H. Wilson
Year Collected: 1911
Locality: Corvallis, Benton, Oregon, United States
  • Syntype: Wilson, H. F. 1912. Aphid notes from Oregon. Canadian Entomologist. 44: 153-159, 191-194.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Illinoia macrosiphum Wilson, 1912
Catalog Number: USNM 399804.001
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;;; Adult; Wings Apterous
Preparation: Slide section
Collector(s): H. Wilson
Year Collected: 1911
Locality: Corvallis, Benton, Oregon, United States
  • Syntype: Wilson, H. F. 1912. Aphid notes from Oregon. Canadian Entomologist. 44: 153-159, 191-194.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acyrthosiphon macrosiphum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGCTCATCTCTTAGAATTCTTATTCGTTTAGAATTAAGACAAATTAATTCAATTATTAATAATAATCAATTATATAATGTAATTGTTACAATCCATGCTTTCATTATAATTTTTTTTATAACTATACCAATTGTAATTGGAGGATTTGGAAACTGATTAATTCCTATAATAATAGGATGTCCTGATATATCTTTTCCACGTTTAAATAATATTAGATTTTGATTACTACCACCATCATTAATAATAATAATCTGTAGATTTTTAATTAATAACGGAACAGGAACAGGATGAACTATTTATCCACCTTTATCAAATAATATTGCACATAATAATATTTCAGTAGATTTAACTATTTTTTCACTACATTTAGCAGGAATCTCATCAATTTTAGGAGCAATTAACTTTATTTGCACAATTTTAAACATAATACCAAATAATATAAAACTAAATCAAATTCCTTTATTTCCATGATCAATTCTAATTACAGCTATTTTATTAATTTTATCTTTACCAGTATTAGCTGGTGCTATTACAATATTATTAACTGATCGTAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATCTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acyrthosiphon macrosiphum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!