Physical Description

Type Information

Paratype for Macrosiphum purshiae Palmer, 1938
Catalog Number: USNM 398039.002
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: ; Unknown
Preparation: Slide section
Collector(s): M. Palmer
Year Collected: 1922
Locality: "Stove Prairie Hill, near Bellvue", Larimer, Colorado, United States
  • Paratype: Palmer, M. A. 1938. Additional aphids from Colorado. Annals of the Entomological Society of America. 31: 352-357.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Macrosiphum purshiae Palmer, 1938
Catalog Number: USNM 398039.001
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;;; Adult; Wings Apterous
Preparation: Slide section
Collector(s): M. Palmer
Year Collected: 1922
Locality: "Stove Prairie Hill, near Bellvue", Larimer, Colorado, United States
  • Holotype: Palmer, M. A. 1938. Additional aphids from Colorado. Annals of the Entomological Society of America. 31: 352-357.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acyrthosiphon purshiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATACTTTTTATTTGGTATCTGATCAGGTATAATTGGATCATCTCTTAGAATTCTAATTCGATTAGAATTAAGACAAATTAATTCTATTATTAATAACAATCAATTGTATAATGTAATTGTCACAATTCATGCTTTCATTATAATTTTTTTTATAACTATACCAATTGTAATTGGTGGATTTGGAAATTGATTAATTCCTATAATAATAGGATGTCCTGATATATCATTTCCACGTTTAAATAATATTAGATTCTGATTATTACCTCCATCATTAATAATAATAATTTGTAGATTTTTAATTAATAATGGTACAGGAACAGGGTGAACAATCTATCCACCTTTATCAAATAATATTGCACATAATAATATTTCAGTTGATCTAACTATTTTTTCACTACATTTAGCAGGAATCTCATCAATTTTAGGAGCAATTAATTTTATTTGTACAATTCTTAATATAATACCAAATAATATAAAACTTAATCAAATCCCTCTTTTCCCTTGATCAATTCTAATCACTGCTATTTTATTAATTTTATCTTTACCAGTTTTAGCTGGTGCTATTACAATATTATTAACCGATCGTAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acyrthosiphon purshiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!