Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 8 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1 - 15
  Temperature range (°C): 23.233 - 28.593
  Nitrate (umol/L): 0.999 - 4.634
  Salinity (PPS): 34.347 - 37.646
  Oxygen (ml/l): 4.163 - 4.635
  Phosphate (umol/l): 0.294 - 0.643
  Silicate (umol/l): 4.140 - 4.346

Graphical representation

Depth range (m): 1 - 15

Temperature range (°C): 23.233 - 28.593

Nitrate (umol/L): 0.999 - 4.634

Salinity (PPS): 34.347 - 37.646

Oxygen (ml/l): 4.163 - 4.635

Phosphate (umol/l): 0.294 - 0.643

Silicate (umol/l): 4.140 - 4.346
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Body changes stiffness: sea cucumber
 

The body of the sea cucumber changes from soft to standard to hard due to stiffening and plastizing factors and exuding water.

   
  "Catch connective tissues or mutable collagenous tissues of echinoderms can extensively change their mechanical properties such as elasticity and viscosity within a few minutes under the regulation of their nervous system. The tissues contain a large amount of the extracellular matrix, mainly consisting of collagen fibrils, proteoglycans and microfibrils. The unique properties of these collagenous tissues might be due to lack of permanent associations between the collagen fibrils and the surrounding extracellular matrix because it is easy to isolate collagen fibrils from catch connective tissues – unlike collagenous tissues of adult vertebrates. It seems that crosslinking of the collagen fibrils with adjacent ones and other components of the extracellular matrix is formed or broken during changes in the mechanical properties of catch connective tissues. The molecular mechanisms underlying the change are, however, not yet fully understood. The holothurian body wall dermis is a typical catch connective tissue that shows rapid and reversible changes in its mechanical properties in response to various stimuli. Extensive studies on the dynamic mechanical properties of the dermis of the sea cucumber Actinopyga mauritiana revealed that the tissue can adopt at least three different states. These are stiff, standard and soft states, which can be distinguished by elastic and viscous properties and by strain-dependent behaviors…The mechanical parameters of the standard state are not simply the intermediate values between the stiff and the soft states, suggesting that the molecular mechanism converting the soft to the standard state is different from that converting the standard to the stiff state." (Yamada et al. 2010:3416)
  Learn more about this functional adaptation.
  • Brienheide R; Tamori M; Motokawa T; Ohtani M; Iwakoshi E; Muneoka Y; Fujita T; Minakata H; Nomoto K. 1998. Peptides controlling stiffness of connective tissue in sea cucumbers. Biological Bulletin. 194: 253-259.
  • Koob TJ; Koob-Edmunds MM; Trotter JA. 1999. Cell-derived stiffening and plasticizing factors in sea cucumber (Cucumaria frondosa) dermis. Journal of Experimental Biology. 202: 2291-2301.
  • Szulgit G. 2007. The echinoderm collagen fibril: a hero in the connective tissue research of the 1990s. BioEssays. 29: 645-653.
  • Tipper JP; Lyons-Levy G; Atkinson MAL; Trotter JA. 2003. Purification, characterization and cloning of tensilin, the collagen-fibril binding and tissue-stiffening factor from Cucumaria frondosa dermis. Matrix Biology. 21: 625-635.
  • Yamada A; Tamori M; Iketani T; Oiwa K; Motokawa T. 2010. A novel stiffening factor inducing the stiffest state of holothurian catch connective tissue. Journal of Experimental Biology. 213: 3416-3422.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:2065
Specimens with Sequences:1449
Specimens with Barcodes:1394
Species:116
Species With Barcodes:96
Public Records:665
Public Species:27
Public BINs:26
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Holothuria cf. cinerascens SU-2008

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGGTTTGGAAACTGACTCATCCCACTGATG---ATAGGAGCACCAGACATGGCCTTCCCCCGAATGAAAAACATGAGATTTTGACTAGTCCCACCCTCCTTCATCCTCCTTCTCGCCTCAGCAGGCGTGGAAAGTGGAGCCGGCACAGGCTGAACAATCTACCCACCCCTATCCAGAAAAATAGCACACGCCGGAGGATCAGTAGACTTA---GCCATTTTTTCCCTACACCTAGCTGGTGCCTCCTCCATTCTAGCTTCTATTAACTTCATAACAACGGTCATAAAAATGCGAACCCCAGGAGTAACATTCGACCGGCTACCACTATTCGTCTGATCAGTATTCATAACAGCATTTCTTCTTCTTTTAAGACTTCCAGTCCTTGCTGGA---GCGATCACAATGCTACTAACCGACCGAAACATAAAAACAACATTTTTCGACCCCGCAGGAGGCGGAGACCCCATCCTATTCCAACACCTGTTCTGATTCTTCGGTCATCCAGAAGTCTATATTCTTATTCTTCCAGGGTTCGGAATGATCTCCCACGTAATAGCTCACTACAGAGGTAAGCAA---GAGCCATTCGGCTATTTAGGAATGGTTTACGCAATGGTAGCAATAGGAATCCTAGGATTTCTAGTATGAGCCCACCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria cf. cinerascens SU-2008

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria n. sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Holothuria

Holothuria is a genus of marine animals of the family Holothuriidae.[2] Members of the genus are found in coastal waters in tropical and temperate regions. They are soft bodied, limbless invertebrates that dwell on the ocean floor. They resemble a cucumber in form.

The genus contains some species that are harvested for food and sold as sea cucumber.

Species[edit]

List of species according to the World Register of Marine Species:




References[edit]

  1. ^ Hansson, H. (2010). "Holothuria Linnaeus, 1767". World Register of Marine Species. Retrieved 2011-12-16. 
  2. ^ http://www.marinespecies.org/aphia.php?p=taxdetails&id=123456
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!