Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Elodia morio is endoparasitoid of larva of Acleris variegana

Animal / parasitoid / endoparasitoid
larva of Phytomyptera cingulata is endoparasitoid of larva of Acleris variegana

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acleris variegana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGTACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATCGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATGATTGGGGGATTTGGTAACTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCACCTTCAATTATACTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCCTTTCATCCAATATTGCCCATAGTGGTAGTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCAGTAAACTTTATTACAACAATTATTAATATACGACCTAATAACATATCATTAGATCAAATACCTTTATTTGTGTGAGCTGTTGGAATTACAGCTTTATTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAACTTAAATACCTCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acleris variegana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acleris variegana

The garden rose tortricid moth or fruit tortricid (Acleris variegana) is a moth of the family Tortricidae. It has a Palaearctic distribution. The moth flies from July to September mainly at night and is attracted to bright lights.[1] The larvae feed on various trees and shrubs including rose and apple.

Morphology[edit]

The fore wing is parallel-sided with an oblique external margin. The basal half is white or yellowish-white and there is a grayish-brown triangular spot close to the wing root. The distal part of the wing is reddish- or violet-brown, edged by a narrow grayish-yellow strip. The hind wing is brownish-gray. The wingspan is 14–20 millimetres (0.55–0.79 in).[2]

Biology[edit]

The eggs are oval, light yellow for the summer generation and milky-white or orange for over-wintering eggs. The larva is yellowish with a shiny brown head. The pupa is 8–9 mm (0.31–0.35 in) long. Hatching caterpillars in spring eat fruit buds. Later they tie leaves into bundles with the help of webbing that they spin. They can skeletonize young leaves and also do damage to buds, flowers, ovaries and unripe fruits. In spring, eggs are laid in large batches. Moths of summer generations lay eggs one by one or in small batches of three to six eggs on leaves, petioles and shoots. Over-wintering eggs are found close to fruit buds.[2]

Distribution[edit]

This is a common species all over Europe and can also be found in Northern and Central Asia, China, Japan and North America.[3]

Economic significance[edit]

The species is a significant pest of plants in the rose family including the rose, apple, pear, plum, sloe and apricot where it is mainly the first generation larvae that do the most damage. Caterpillars also cause damage to quince, cherry, hawthorn, almonds, cotoneaster and bird cherry. Other species on which they occasionally feed include hazel, oak, elm, willow and shrubs of the genus Vaccinium. They can be controlled by chemical or biological methods.[2]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!