Overview

Comprehensive Description

General Description

Mature larvae are 20-22 mm long, yellowish brown with black heads. Adults with grey head and thorax, rarely reddish brown in females. Forewing typically gray with suffused, indistinct markings. Males occasionally and females more commonly have reddish brown hue. Hind wing uniformly dark brown or grayish black. Fringe whitish with dark basal line. Wingspan: males 21-26 mm, females 22-30 mm. For more detailed information see Freeman (1967). Color and pattern of the forewing can vary significantly and morphological resemblances among conifer-feeding Choristoneura make it very difficult to distinguish species using external morphological characteristics (Dang 1985). To identify species, other characters should be considered such as genitalia (Dang 1985, Dang 1992), mitochondrial DNA (Sperling & Hickey 1995) or behavioural characteristics such as host plant preference, larval diapause or pheromone attraction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mainly associated with boreal, Great Lakes-St. Lawrence and Acadian forest regions where balsam fir and white spruce are found. Ranges from the Atlantic provinces to the Rocky Mountains in Alberta and northward to the Arctic circle in the Mackenzie River valley and the Yukon (Harvey 1984).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Balsam fir (Abies balsamea) and white spruce (Picea glauca) forests.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Principal hosts are balsam fir and white spruce but will also feed on black (Picea mariana), red (Picea rubens), Norway (Picea abies), Engelmann (Picea engelmannii), and Colorado (Picea pungens) spruce, as well as hemlock (Tsuga heterophylla), larch (Larix laricina, Larix occidentalis) and subalpine fir (Abies lasiocarpa) (Harvey 1984, Cerezke 1991).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults first appear in mid June and are present throughout July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Female adult lays up to 200 eggs during a two week period in July. Eggs are laid in masses of 15-50 that resemble overlapping green scales along undersides of needles. Eggs hatch in 10 days and larvae spin silken hibernation shelters under bark scales, lichens or in old staminate flower cups to overwinter (Cerezke 1991, EPPO 2004). Larvae emerge from hibernation the following year from late April to mid May just before vegetative buds begin expanding. They mine into old needles, unopened buds, or feed on staminate flowers. Eventually they move to opening buds where they produce a silken cover to feed under. Larvae spin loose webs among the needles which they use to move to new foliage as the shoots expand. Larvae drop to lower branches or remain in feeding webs to pupate after the sixth larval instar. Adults emerge approximately 10 days after pupation. One generation per year (EPPO 2004).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Choristoneura fumiferana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 48 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCAACAAATCATAAGGATATTGGAACATTATATTTTATATTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGTGAT---GATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCCTCTATTATACTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGTACAGGATGAACAGTATACCCCCCACTTTCATCCAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACTATTATTAATATACGACCAAATAATATATCTTTAGACCAAATACCCTTATTTGTATGATCAGTAGGAATTACAGCTCTTTTACTTCTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAACACATCATTTTTCGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATCTCTCATATTATTTCACAAGAAAGAGGTAAAAAAGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTACTGGGATTTGTAGTTTGAGCTCATCATATATTTACAGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Choristoneura fumiferana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 201
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Choristoneura fumiferana

Choristoneura fumiferana Adult and Puppa

Choristoneura fumiferana, the Eastern Spruce Budworm, is a species of moth of the Tortricidae family. It is one of the most destructive native insects in the northern spruce and fir forests of the Eastern United States and Canada. According to one common theory, popularized in the 1970s, periodic outbreaks of the spruce budworm are a part of the natural cycle of events associated with the maturing of balsam fir. The catastrophe theory of budworm outbreaks holds that particularly major infestations occur every 40–60 years, as the result of a cusp-catastrophe event, whereby populations jump suddenly from endemic to epidemic levels. An alternative theory holds that outbreaks are the result of spatially synchronized population oscillations that are caused by delayed density-dependent feedback (from various mortality agents) which are synchronized via a process of entrainment.

The first recorded outbreak of the spruce budworm in the United States occurred in Maine about 1807. Another outbreak followed in 1878. Since 1909 there have been waves of budworm outbreaks throughout the Eastern United States and Canada. The States most often affected are Maine, New Hampshire, New York, Michigan, Minnesota, and Wisconsin. These outbreaks have resulted in the loss of millions of cords of spruce and fir. In 20th century eastern Canada, the major outbreaks occurred in the time periods ~1910-20, ~1940-50, and ~1970-80. Longer-term tree-ring studies suggest that spruce budworm outbreaks have been recurring every three decades or so since the 16th century. Paleoecological studies suggest the spruce budworm has been outbreaking in eastern North America for thousands of years.

Balsam Fir is the species most severely damaged by the budworm in the Eastern United States. White, Red, and Black Spruce are suitable host trees and some feeding may occur on tamarack, pine, and hemlock. Spruce mixed with Balsam Fir is more likely to suffer budworm damage than spruce in pure stands.

The range of the spruce bud-worm includes the Northern States east of Montana but the budworm is found wherever host species grow.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!