Overview

Comprehensive Description

General Description

Mature larvae are 20-22 mm long, yellowish brown with black heads. Adults with grey head and thorax, rarely reddish brown in females. Forewing typically gray with suffused, indistinct markings. Males occasionally and females more commonly have reddish brown hue. Hind wing uniformly dark brown or grayish black. Fringe whitish with dark basal line. Wingspan: males 21-26 mm, females 22-30 mm. For more detailed information see Freeman (1967). Color and pattern of the forewing can vary significantly and morphological resemblances among conifer-feeding Choristoneura make it very difficult to distinguish species using external morphological characteristics (Dang 1985). To identify species, other characters should be considered such as genitalia (Dang 1985, Dang 1992), mitochondrial DNA (Sperling & Hickey 1995) or behavioural characteristics such as host plant preference, larval diapause or pheromone attraction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mainly associated with boreal, Great Lakes-St. Lawrence and Acadian forest regions where balsam fir and white spruce are found. Ranges from the Atlantic provinces to the Rocky Mountains in Alberta and northward to the Arctic circle in the Mackenzie River valley and the Yukon (Harvey 1984).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Balsam fir (Abies balsamea) and white spruce (Picea glauca) forests.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Principal hosts are balsam fir and white spruce but will also feed on black (Picea mariana), red (Picea rubens), Norway (Picea abies), Engelmann (Picea engelmannii), and Colorado (Picea pungens) spruce, as well as hemlock (Tsuga heterophylla), larch (Larix laricina, Larix occidentalis) and subalpine fir (Abies lasiocarpa) (Harvey 1984, Cerezke 1991).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults first appear in mid June and are present throughout July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Female adult lays up to 200 eggs during a two week period in July. Eggs are laid in masses of 15-50 that resemble overlapping green scales along undersides of needles. Eggs hatch in 10 days and larvae spin silken hibernation shelters under bark scales, lichens or in old staminate flower cups to overwinter (Cerezke 1991, EPPO 2004). Larvae emerge from hibernation the following year from late April to mid May just before vegetative buds begin expanding. They mine into old needles, unopened buds, or feed on staminate flowers. Eventually they move to opening buds where they produce a silken cover to feed under. Larvae spin loose webs among the needles which they use to move to new foliage as the shoots expand. Larvae drop to lower branches or remain in feeding webs to pupate after the sixth larval instar. Adults emerge approximately 10 days after pupation. One generation per year (EPPO 2004).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Choristoneura fumiferana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 48 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCAACAAATCATAAGGATATTGGAACATTATATTTTATATTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGTGAT---GATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCCTCTATTATACTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGTACAGGATGAACAGTATACCCCCCACTTTCATCCAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACTATTATTAATATACGACCAAATAATATATCTTTAGACCAAATACCCTTATTTGTATGATCAGTAGGAATTACAGCTCTTTTACTTCTTTTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAACACATCATTTTTCGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATCTCTCATATTATTTCACAAGAAAGAGGTAAAAAAGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTACTGGGATTTGTAGTTTGAGCTCATCATATATTTACAGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Choristoneura fumiferana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 201
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Choristoneura fumiferana

Choristoneura fumiferana Eggs
Choristoneura fumiferana Caterpillar
Choristoneura fumiferana Adult and Puppa

Choristoneura fumiferana, the Eastern Spruce Budworm, is a species of moth of the Tortricidae family. It is one of the most destructive native insects in the northern spruce and fir forests of the Eastern United States and Canada. According to one common theory, popularized in the 1970s, periodic outbreaks of the spruce budworm are a part of the natural cycle of events associated with the maturing of balsam fir. The catastrophe theory of budworm outbreaks holds that particularly major infestations occur every 40–60 years, as the result of a cusp-catastrophe event, whereby populations jump suddenly from endemic to epidemic levels. An alternative theory holds that outbreaks are the result of spatially synchronized population oscillations that are caused by delayed density-dependent feedback (from various mortality agents) which are synchronized via a process of entrainment.

The first recorded outbreak of the spruce budworm in the United States occurred in Maine about 1807. Another outbreak followed in 1878. Since 1909 there have been waves of budworm outbreaks throughout the Eastern United States and Canada. The States most often affected are Maine, New Hampshire, New York, Michigan, Minnesota, and Wisconsin. These outbreaks have resulted in the loss of millions of cords of spruce and fir. In 20th century eastern Canada, the major outbreaks occurred in the time periods ~1910-20, ~1940-50, and ~1970-80. Longer-term tree-ring studies suggest that spruce budworm outbreaks have been recurring every three decades or so since the 16th century. Paleoecological studies suggest the spruce budworm has been outbreaking in eastern North America for thousands of years.

Taxonomy[edit]

When the spruce budworm, fumiferana (Clemens), was recognized as a Nearctic representative of the genus Choristoneura Lederer (Freeman 1947),[2] the name applied to populations in a variety of geographic regions and biotopes. Later, C. pinus Free., a distinct form that feeds on pines was established as a separate species, but a large group in the western part of North America remained taxonomically undefined as the “western complex” (Freeman 1953),[3] until Freeman (1967)[4] established several new species. Field collections of late instar larvae of Choristoneura populations from a wide range of localities in a wide arc, from the Atlantic seaboard along the edge of the Laurentian Shield to the Mackenzie River area near the Arctic Ocean, yielded Choristoneura fumiferana (Clem.) sensu strico only from points east of the Rocky Mountain foothills (Stehr 1967).[5] The 2-year-cycle budworm, C. biennis Free. occurs only in the Subalpine forest region (Halliday 1937, Rowe 1959),[6][7] with alpine fir and interior spruce as hosts. Budworm populations from Rocky Mountain regions south of the area of introgressive hybridization of spruce differ from C. biennis (Stehr 1967).[5] Other budworms are of little or no consequence with respect to spruces.

Dietary preferences[edit]

The spruce budworm normally feeds almost exclusively on current-year needles of balsam fir and white spruce (Blais 1958a),[8] but in massive outbreaks populations of the insect can become so high that the larvae feed to some extent on old foliage (Swaine et al. 1924, Balch et al. 1954).[9][10] Balsam fir is the most susceptible host; annual defoliation of current-year growth for 5 to 8 years kills the host tree (Belyea 1952).[11]

The main hosts of the spruce budworm in eastern North America are balsam fir, white spruce, and black spruce (Blais 1964, 1980).[12][13] White spruce is particularly useful for providing evidence, through radial-growth data, of past outbreaks of spruce budworm (Blais 1962).[14] Red spruce, in its limited distribution, is also attacked, as is tamarack (Sippell 1983).[15] Significant damage is also caused to subalpine fir (Harvey 1985).[16]

Nevertheless, balsam fir is the most susceptible host, and defoliation by spruce budworm is most clearly reflected in the fir’s radial growth, the shorter lifespan of the fir compared with that of the spruces, together with the great vulnerability of balsam fir to lethal budworm attack (Blais 1958b, 1981b; Blais and Archambault 1982),[17][18][19] greatly reduce the number of mature balsam fir in the forest. Balsam fir mortality greater than 75% occurred in a budworm outbreak in Quebec, in stands in which no mortality was reported among the small component of white spruce (Blais and Martineau 1960).[20] Consequently, balsam fir generally cannot be used to obtain information on outbreaks more than 75 years previously. White spruce trees, however, can provide excellent records over periods as long as 200, and sometimes 300 years (Blais 1962).[14] While white spruce is less susceptible than balsam fir to budworm attack, heavy defoliation with resulting diminution of radial growth occurs in severe outbreaks (Blais 1985).[21] In lesser outbreaks, the resulting moderate reduction of growth is often difficult to distinguish from random or weather-related fluctuations, but comparisons between the radial growth in host trees with that in non-host trees (especially white and red pines) are used to detect the budworm effect. Blais (1962, 1965)[14][22] was able to determine the time of occurrence, the geographical extent, the intensity, and duration of past spruce budworm infestations for the Lac Seul area of northwestern Ontario, the Gaspé and St. Lawrence regions, and the Laurentide park region of Quebec, with the information covering the previous 100 years for the first 2 regions and the previous 300 years for the last region, where evidence was found of 5 successive outbreaks between 1670 and 1960.

The dietary preference of the eastern budworm for balsam fir over white spruce has the potential to alter the structure and composition of the spruce–fir forest (Bichon 1995).[23] Similarly, late instar larvae that disperse to the understorey and feed on regeneration will influence the next stand. Bichon sampled spruce budworm populations by collecting 45 cm branches from the upper mid-crowns of the nearest dominant or co-dominant balsam fir and white spruce at 20 randomly selected points within each of 4, 10-ha study plots in the Black Sturgeon Lake area near Thunder Bay, Ontario. The number of late-instar larvae captured in water traps located on the ground at the drip line of each sampled tree was recorded throughout the dispersal period. The data combined from all plots surprisingly indicated that white spruce canopies contained more spruce budworm than balsam fir canopies. The mean number of budworm per branch on white spruce was 2 to 3 times greater than that on balsam fir on all sample dates, and a similar pattern was found in the number of late-instar larvae dispersing to the understorey. Water traps under white spruce trees captured more than 3 times as many larvae as did those under balsam fir trees for most of the dispersal period. One water trap (with a surface area of only 1250 cm2) under a white spruce collected 73 larvae in 2 days.

While balsam fir is undoubtedly the host of preference, severe outbreaks have occurred in the Prairie Provinces and Northwest Territories in white spruce stands containing little or no balsam fir (Ives and Wong 1988).[24] In severe outbreaks in north-central Ontario, young white spruce and black spruce outplants in cutovers became infested with dozens of late-stage larvae (Sutton 1982).[25] Mortality among white spruce has also occurred in northwestern Ontario and the Algoma District of Ontario, as well as in certain areas of New Brunswick (Blais 1976).[26] An ambitious study to determine (1) the degree of vulnerability of white spruce to budworm attack, (2) the rate of mortality with respect to defoliation, stand age and composition, geographical location, and relative to mortality among balsam fir, (3) sequence of attack by secondary insects, and (4) the rate of deterioration of killed trees, was begun in 1975 (Blais 1976) when 10 line plots 60 m wide averaging 0.5 km in length were established in mature stands of white spruce about 14 km apart along bush roads in the Dumoine and Coulonge river watersheds of western Quebec. There were 25 to 60 living trees per plot, all these and any dead white spruce were marked (Table 5.11).

Outbreaks[edit]

Massive outbreaks of spruce budworm occur irregularly throughout the range, but populations of this insect can remain at an endemic level for long periods (Blais 1985).[21] In 1943, a continuing outbreak in Ontario and western Quebec was causing heavy mortality, particularly in stands of balsam fir (Atwood 1945):[27] half of the 25 million cords (90,615,000 m3) of balsam fir standing in 1931 were estimated to have died or injured beyond recovery, while millions of cords of white spruce were also probably killed. Atwood also noted the increased difficulty of logging in budworm-affected stands as well as the increased risk of fire. Past outbreaks, instead of affecting the whole area subject to budworm infestation, have occurred in separate regions (Blais 1968).[28] Within affected regions, epidemics did not recur regularly. In the lower St. Lawrence and Gaspé regions, for instance, radial-growth studies of balsam fir and white spruce confirmed outbreaks known to have taken place in the lower St. Lawrence in 1878 and 1912 (Blais 1961a).[29] The Gaspé had been thought to have escaped those outbreaks, but Blais found clear evidence that the 1912 outbreak had covered more than 2 million ha in that region.

Further evidence obtained by Blais (1965)[22] from determinations of radial growth on basal disks of balsam fir, white spruce, and black spruce (susceptible species), and non-susceptible white pine in the Laurentide Park, Quebec, led him to conclude that outbreaks had occurred about 1704, 1748, 1808, 1834, 1910, and 1947. The more recent outbreaks seemed to have been more severe than earlier ones, possibly, he suggested, due to an increase in numbers of highly susceptible balsam fir and a decrease in numbers of less susceptible white spruce following harvesting operations (Blais 1976).[26]

Evidence of a budworm attack in the Lake Nipigon region of Ontario contemporaneously with the 1704 outbreak in Quebec’s Laurentide Park was adduced by Turner (1952),[30] based on the pattern of radial growth in a single 300-year-old white spruce that showed a characteristic budworm suppression pattern beginning in 1702 and lasting for 10 years (Blais 1962).[14] Intensive searches failed to find other white spruce of similar age.

Spruce budworm outbreaks usually first appear in localized areas before spreading to immense territories (Blais 1961b).[31] Population explosions can be astonishingly rapid. In the Kedgwick Lake area of Quebec, for instance, egg sampling in summer 1959 had indicated that budworm populations would be low in 1960, but a much higher than expected population developed in response to favourable weather and food conditions. Such situations are unlikely to recur frequently, but population spread through wind dispersal of small larvae is relatively common. Unfavourable weather in the spring can strongly influence both budworm and host development (Blais 1981a, Luciuk 1984).[32][33]

Damage[edit]

The spruce budworm Choristoneura fumiferana Clemens (Lepidoptera: Torticidae), “the most destructive forest insect in North America” (Rose and Lindquist 1985),[34] erupts periodically in massive epidemics in spruce–fir forests in northern and eastern Canada. Populations of spruce budworm vary in density over several orders of magnitude. Recorded densities in the boreal forest range from less than 0.01 (Miller and Renault 1976)[35] to more than 100 larvae per 45 cm branch tip (Henry 1996).[36]

Damage can begin even before buds have flushed. Early instar larvae mine and kill the buds. Late instar larvae are voracious and wasteful feeders, chewing off needles at their bases. In heavy infestations, old foliage is also eaten. Increment loss, tree deformity, and mortality follow several years of heavy infestation (Brown 1971, Blais 1980).[13][37]

Defoliation of trees reduces their photosynthetic capacity and therefore curtails growth. In conifers, reduction in radial growth does not normally coincide with the first year of defoliation. For instance, the ring width of white spruce defoliation by the European spruce sawfly (Gilpinia hercyniae Htg.) showed reduced growth beginning in the year after defoliation; the reduction occurred throughout the stem but was greatest in the lower part (Reeks and Barter 1951).[38] In a preliminary study, repeated severe defoliation of white spruce by the spruce budworm was not reflected in reduced radial increment at breast height during the first 3 or 4 years (Blais 1954).[39] But in the Lac Seul infestation in northwestern Ontario, apparent radial growth suppression at breast height in white spruce first occurred in the 2nd year of severe defoliation in 2 plots and in the 3rd year in 1 plot (Blais 1958a).[8]

Forest production in central New Brunswick would have been reduced to 20% of normal, with a loss of some 2400 man-years of employment annually, had not the program of spraying against the budworm been carried out (MacDonald 1968).[40] The cost of the program, $11,600,000 for 1952 to 1958 and $10,200,000 for 1960 to 1967, was but a small fraction of the value of the resource saved.

Range[edit]

The range of the insect coincides with the range of its hosts. In Ontario, the spruce budworm oviposits on needles of host trees in late June/early July. Large numbers of egg masses are deposited on the peripheral shoots of the crown. The number of eggs per egg mass varies from 1 to about 60, but commonly averages 20 (Sanders 1991).[41] About 90 parasitoids have been collected from spruce budworm in eastern North America. Henry (1996)[36] found the suite of parasitoids collected from spruce budworm in isolated white spruce plantations in southern Ontario differed from the usual suite of parasitoids found in the boreal forest.

Control[edit]

Pest management implies some manipulation of the environment to adversely affect an organism that is using it in a way that is incompatible with our own use (MacDonald 1968).[40] The manipulation is effected through cultural practice, or by the introduction of a regulatory agent such as a predator or an insecticide. In regard to massive outbreaks, the use of insecticide is the only practical method of crop protection.

In New Brunswick, over 3,600,000 ha was sprayed at least once between 1952 and 1967 (MacDonald 1968).[40] Most of the sprayed forests were still “in good condition” in 1968, and, although a scattering of dead trees occurred throughout the region, in no case did mortality destroy a major operating unit or disrupt a long-term management plan. In contrast, mortality in 2 unsprayed check areas, each 155 km2, exceeded 65%.

The effectiveness of inundative releases of Trichogramma minutum Ril. for biological control of Choristoneura fumiferana was investigated by Smith et al. (1986)[42] in the Canadian boreal forest in 1982–83. The time of release, parasite density, and local weather were the most significant factors affecting the level of egg parasitism. The food supply of adult female parasites, vertical location of the host egg-mass in the stand, intensity of solar radiation and density of the host were less important. Parasitism of eggs was similar on white spruce and balsam fir. Parasites reared at different temperatures and on different host eggs differed in biological characteristics, with undetermined effects on the success of field releases. Geographical strains of Trichogramma minutum were not considered as important as rearing conditions in subsequent releases because of the high degree of individual variation within each strain.

References[edit]

  1. ^ tortricidae.com
  2. ^ Freeman, T.N. 1947. A new generic assignment for Archips fumiferana (Clemens), the spruce budworm. Can. Entomol. 79:21.
  3. ^ Freeman, T.N. 1953. The spruce budworm Choristoneura fumiferana (Clem.) and an allied new species on pine (Lepidoptera: Tortricidae). Can. Entomol. 85:121–127.
  4. ^ Freeman, T.N. 1967. On coniferophagous species of Choristoneura (Lepidoptera: Tortricidae) in North America. I. Some new forms of Choristoneura allied to C. fumiferana. Can. Entomol. 99:449–455.
  5. ^ a b Stehr, G.W. 1967. On coniferophagous species of Choristoneura (Lepidoptera: Tortricidae) in North America. II. Geographic distribution in accordance with forest regions. Can. Entomol. 99:456–463.
  6. ^ Halliday, W.E.D. 1937. A forest classification for Canada. Can. Dep. Mines and Resources, Dominion For. Serv., Ottawa ON, Bull. 89. 50 p.
  7. ^ Rowe, J.S. 1959. Forest regions of Canada. Ottawa, Dept. Northern Affairs & National Resources, Forestry Branch. 71 p.
  8. ^ a b Blais, J.R. 1958a. Effects of defoliation by spruce budworm (Choristoneura fumiferana (Clem.) on radial growth at breast height of balsam fir (Abies balsamea [L.] Mill.) and white spruce (Picea glauca [Moench] Voss). For. Chron. 34:39–47.
  9. ^ Swaine, J.M.; Craighead, F.C.; Bailey, J.W. 1924. Studies on the spruce budworm Cacoecia fumiferana Clem. Can. Dep. Agric., Ottawa ON, Tech. Bull. 37 (N.S.).
  10. ^ Balch, R.E.; Webb, F.E.; Morris, R.F. 1954. Results of spraying against spruce budworm in New Brunswick. Can. Dep. Agric., For. Biol. Div., Ottawa ON, Bi-mo. Progr. Rep. 10(1).
  11. ^ Belyea, R.M. 1952. Death and deterioration of balsam fir weakened by spruce budworm defoliation in Ontario. J. For. 50:729–738.
  12. ^ Blais, J.R. 1964. Account of a recent spruce budworm outbreak in the Laurentide Park region of Quebec and measures for reducing damage in future outbreaks. For. Chron. 40(3):313–323.
  13. ^ a b Blais, J.R. 1980. Condition du sapin et de l’épineete blanche dans la région du parc des Laurentides en 1979 face à l’épidémic de al tordeuse et prévision des peretes. Can. ^^^, Laurentian For. Res. Centre, Ste.-Foy QC, Inf. Rep. LAU-X-43. 16 p.
  14. ^ a b c d Blais, J.R. 1962. Collection and analysis of radial-growth data from trees for evidence of past spruce budworm outbreaks. For. Chron. 38(4):474–484.
  15. ^ Sippell, W.L. 1983. A review of the spruce budworm and its outbreak history. p. 17–25 in Sanders, C.J.; Carrow, J.R. (Eds.). The spruce budworm problem in Ontario – real or imaginary? Can.–Ont. Joint For. Res. Committee Sympos., Timmins ON, Sept. 1982. COJFRC Sympos. Proc. O-P-11.
  16. ^ Harvey, G.T. 1985. The taxonomy of the coniferophagous Choristoneura (Lepidoptera: Tortricidae): a review. p. 16–48 in Sanders C.J., Stark, R.W., Mullins, E.J.; Murphy, J. (Eds.). Recent Advances in Spruce Budworms Research. CANUSA Spruce Budworms Research Symp. Proc., Bangor ME, Sept. 1984. Can For. Serv./USDA For. Serv., Ottawa ON.
  17. ^ Blais, J.R. 1958b. The vulnerability of balsam fir to spruce budworm attack in northwestern Ontario, with special reference to the physiological age of the tree. For. Chron. 34(4):405–422.
  18. ^ Blais, J.R. 1981b. Mortality of balsam fir and white spruce following a spruce budworm outbreak in the Ottawa River watershed in Quebec. Can. J. For. Res. 11(3):620–629.
  19. ^ Blais, J.R.; Archambault, L. 1982. Rating vulnerability of balsam fir to spruce budworm attack in Quebec. Can. For. Serv., Ste.-Foy QC, Inf. Rep. LAU-X-51. 19 p.
  20. ^ Blais, J.R.; Martineau, R. 1960. A recent spruce budworm outbreak in the lower St. Lawrence amd Gaspé Peninsula with reference to aerial spraying operations. For. Chron. 36(3):209–224.
  21. ^ a b Blais, J.R. 1985. The ecology of the eastern spruce budworm: a review and discussion. p. 49–59 in Sanders C.J.; Stark, R.W.; Mullins, E.J.; Murphy, J. (Eds.). Recent Advances in Spruce Budworms Research. CANUSA Spruce Budworms Research Symp. Proc., Bangor ME, Sept. 1984. Can For. Serv./USDA For. Serv., Ottawa ON.
  22. ^ a b Blais, J.R. 1965. Spruce budworm outbreaks in the past three centuries in the Laurentide Park, Quebec. For. Sci. 11(2):130–138.
  23. ^ Bichon, R. 1995. Canopy population and late instar dispersal of eastern spruce budworm: balsam fir versus white spruce. p. 25 in Carroll, A.L. and Raske, A.G. (Ed./Comp.). Proc. Eastern Spruce Budworm Research Conference, St. John’s NL, April 1994.
  24. ^ Ives, W.G.H.; Wong, H.R. 1988. Tree and shrub insects of the prairie provinces. Gov’t Can., Can. For. Serv., Edmonton AB, Inf. Rep. NOR-X-292. 327 p.[Coates et al. 1994]
  25. ^ Sutton, R.F. 1982. Plantation establishment in the boreal forest: planting season extension. Can. Dep. Environ., Can. For. Serv., Sault Ste. Marie ON, Inf. Rep. O-X-344. 129 p.
  26. ^ a b Blais, J.R. 1976. Preliminary observations on the vulnerability of white spruce to spruce budworm defoliation in western Quebec. Environ. Can., Can. For. Serv., Ottawa ON, Bi-mo. Res. Notes 32(2):10–11.
  27. ^ Atwood, C.E. 1945. The status of the spruce budworm in Ontario and western Quebec. Entomol. Soc. Ont., 74th Ann. Rep.:52–54.
  28. ^ Blais, J.R. 1968. Regional variation in susceptibility of eastern North American forests to budworm attack based on history of outbreaks. For. Chron. 44(3):17–23 [reprint, separate pagination].
  29. ^ Blais, J.R. 1961a. Spruce budworm outbreaks in the lower St. Lawrence and Gaspé regions. For. Chron. 37(3):192–202.
  30. ^ Turner, K.B. 1952. The relation of mortality of balsam fir caused by the spruce budworm to forest composition in the Algoma forest of Ontario. Can. Dep. Agric., Ottawa ON, Publ. 875. 107 p.
  31. ^ Blais, J.R. 1961b. Aerial application of insecticides and the suppression of incipient budworm outbreaks. For. Chron. 37(3):203–210.
  32. ^ Blais, J.R. 1981a. Effects of late spring frosts in 1980 on spruce budworm and its host trees in the Laurentian Park region of Quebec. Can. For. Serv., Ottawa, ON. Res. Notes 1(3):16–17.
  33. ^ Luciuk, G.S. 1984. Effect of climatic factors on post-diapause emergence and survival of spruce budworm larvae (Lepidoptera: Tortricidae). Can. Entomol. 116:1077–1083.
  34. ^ Rose, A.H.; Lindquist, O.H. 1985. Insects of eastern spruces, fir and, hemlock, revised edition. Gov’t Can., Can. For. Serv., Ottawa, For. Tech. Rep. 23. 159 p. (cited in Coates et al. 1994, cited orig ed 1977)
  35. ^ Miller, C.A.; Renault, T.R. 1976. Incidence of parasitoids attacking endemic spruce budworm (Lepidoptera: Tortricidae) populations in New Brunswick. Can. Ent. 108:1045–1052.
  36. ^ a b Henry, B.S. 1996. Spruce budworm parasitoid investigations in southern Ontario white spruce plantations. MSc thesis, Univ. Guelph, Guelph ON. 187 p.
  37. ^ Brown, R.G. 1971. Spruce budworm in British Columbia. Can. Dep. Environ., Can. For. Serv., Victoria BC, For. Insect & Disease Survey, Pest Leaflet 31. 4 p.
  38. ^ Reeks, W.A.; Barter, G.W. 1951. Growth reduction and mortality of spruce caused by the European spruce sawfly Gilpinia hercyniae (Hymenoptera: Diprionidae). For. Chron. 27(2):140–156.
  39. ^ Blais, J.R. 1954. The recurrence of spruce budworm infestations in the past century in the Lac Seul area of northwestern Ontario. Ecology 35:62–71.
  40. ^ a b c MacDonald, D.R. 1968. Management of spruce budworm populations. For. Chron. 44(3):33–36 (separate pagination).
  41. ^ Sanders, C.J. 1991. Biology of North American spruce budworms. p. 579–520 in van der Geest, L.P.S.; Evenhuis, H.H. (Eds.). Tortricid Pests, their Biology, Natural Enemies and Control. Elsevier Science, Amsterdam [Dordrecht], The Netherlands.
  42. ^ Smith, S.M.; Hubbes, M.; Carrow, J.R. 1986. Factors affecting inundative releases of Trichogramma minutum Ril. against the spruce budworm. J. Appl. Entomol. 101(1):29–39.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!