Molecular Biology and Genetics

Molecular Biology

Barcode data: Syndemis musculana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCATTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGGGATGACCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTATTATACTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTTCATCAAATATCGCCCATAGTGGAAGTTCTGTAGATCTAGCAATTTTTTCTTTACATTTAGCTGGTATCTCATCAATTTTAGGAGCTGTAAATTTTATCACAACTATTATTAACATACGACCAAATAATATATCTTTAGATCAAATACCCTTATTTGTTTGATCTGTCGGAATTACAGCTCTTCTACTATTATTATCATTACCTGTATTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syndemis musculana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Syndemis musculana

The name of the present species was misapplied to S. afflictana by Baron Walsingham in 1879.

Syndemis musculana is a moth of the family Tortricidae. It is found in Europe, China (Heilongjiang, Jilin, Inner Mongolia), the Korean Peninsula, Japan, Russia (Amur) and North America.[1]

Larva

The wingspan is 15–22 mm. The adults fly from April to July in the temperate parts of their range, such as Belgium and The Netherlands.

The caterpillars feed on oaks (Quercus), birches (Betula), spruces (Picea), ragworts (Senecio) and Rubus (brambles and allies). Less usually, they have been recorded[2] to eat plant refuse and dry leaves.

Synonyms[edit]

Obsolete scientific names of this species are:

  • Cacoecia musculana (Hübner, 1799)[2]
  • Syndemis musculana nipponensis Yasuda, 1975
  • Tortrix musculana Hübner, 1799
  • Tortrix musculinana (lapsus)
  • Tortrix obsoletana Strand, 1901

References[edit]

  • Grabe, Albert (1942): Eigenartige Geschmacksrichtungen bei Kleinschmetterlingsraupen ["Strange tastes among micromoth caterpillars"]. Zeitschrift des Wiener Entomologen-Vereins 27: 105-109 [in German]. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!