Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 103
Specimens with Sequences: 94
Specimens with Barcodes: 94
Species: 4
Species With Barcodes: 4
Public Records: 83
Public Species: 3
Public BINs: 4
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Noctilio albiventris PS1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTATTATTCGGTGCCTGAGCCGGAATAGTAGGAACTGCCCTAAGCCTAATTATCCGAGCGGAGTTAGGTCAACCAGGCACTTTACTTGGCGATGACCAAATTTATAATGTCGTAGTAACAGCCCACGCTTTCGTAATAATCTTCTTTATAGTAATACCTATTATAATCGGTGGATTTGGCAATTGATTGGTTCCATTAATAATTGGGGCACCAGACATGGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTACTCCCCCCATCTTTCCTATTACTACTAGCCTCCTCAATAGTTGAAGCCGGGGCAGGGACCGGATGAACCGTCTACCCTCCTTTAGCAGGCAACTTAGCCCACGCTGGAGCTTCAGTAGATCTTGCAATTTTCTCTCTTCACCTAGCAGGGGTCTCATCCATTCTTGGTGCTATCAATTTTATTACTACTATTATTAATATAAAACCCCCAGCTCTATCCCAATATCAAACTCCCCTATTCGTATGATCAGTACTAATTACAGCCGTTCTACTTCTATTGTCCCTTCCTGTACTAGCTGCGGGCATCACTATGCTATTAACAGACCGGAACCTAAATACCACTTTCTTTGACCCTTGTGGGGGAGGAGATCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Noctilio albiventris PS1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Noctilio albiventris PS2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTACTATTCGGTGCTTGAGCCGGAATAGTAGGAACTGCCCTAAGCCTAATTATCCGAGCAGAATTAGGTCAACCAGGTACTTTGCTTGGCGATGACCAAATTTATAATGTCGTAGTAACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCTATTATAATTGGCGGATTTGGCAACTGATTGGTTCCATTAATAATTGGAGCACCAGACATAGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTACTCCCCCCATCTTTCCTGTTACTACTAGCCTCCTCAATAGTTGAGGCCGGGGCGGGGACCGGATGAACCGTCTACCCTCCTTTAGCAGGCAACTTAGCCCACGCTGGAGCTTCAGTAGATCTTGCAATTTTCTCTCTTCACCTAGCAGGGGTCTCCTCCATTCTTGGTGCTATCAATTTTATTACAACTATTATCAATATAAAACCCCCAGCCCTCTCCCAATACCAAACCCCCCTATTCGTGTGATCAGTACTAATTACAGCCGTTCTGCTCCTATTATCTCTTCCTGTACTAGCTGCGGGCATCACCATACTACTAACAGACCGGAACCTAAACACTACCTTCTTCGACCCATGCGGAGGGGGGGATCCAATTCTTTATCAGCACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Noctilio albiventris PS2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bulldog bat

The bat family Noctilionidae, commonly known as bulldog bats or fisherman bats, is represented by two species, the greater and the lesser bulldog bats.[1] They are found near water, from Mexico to Argentina and also in the Caribbean islands. The naked bulldog bat (Cheiromeles torquatus) does not belong to this family, but to the family Molossidae, the free-tailed bats.

The bulldog bats have orange to brown fur, and range in head-body length from 7 to 14 cm. They have relatively long legs, large feet exceptionally so in the case of the greater bulldog bat and strong claws.Their wings are long and narrow and their ears are large and funnel shaped. Unusual among bats, they have cheek-pouches for storing food. They also have full lips divided by a fold of skin giving a 'hare lip' look which together with the cheek pouches gives them their bulldog-like appearance. The species of lesser bulldog bats are insectivorous and whilst the greater bulldog bats also eat insects their chief food is fish.[2] They use their echolocation to pinpoint the ripples they make on the surfaces of water.[3]

The greater bulldog bat trawls the water with its long, curved talons approximately 2–3 cm below the surface. It makes sweeps of between 30 cm and 3 m before ascending and turning to make a return sweep. In a single night, the bat may catch 20-30 small fish in this way.[4]

References[edit]

  1. ^ Simmons, Nancy B. (2005). "Chiroptera". In Wilson, Don E.; Reeder, DeeAnn M. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed). Baltimore: Johns Hopkins University Press. pp. 312–529. ISBN 978-0-8018-8221-0. Retrieved 4 October 2009 
  2. ^ McDonald D. ed 2010 The Encyclopedia of Mammals Oxford University Press ISBN 978-0-19-956799-7 p466
  3. ^ Macdonald, D., ed. (1984). The Encyclopedia of Mammals. New York: Facts on File. p. 805. ISBN 0-87196-871-1. 
  4. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!