Overview

Brief Summary

Ascaris lumbricoides is the largest nematode (roundworm) parasitizing the human intestine (adult females are 20 to 35 cm and adult males 15 to 30 cm in length). Infection with this parasite is known as ascariasis and is the most common helminthic infection in the world ("helminth" is a functional term, rather than a meaningful taxonomic one, referring to any worm-like internal parasite and used mainly to refer to parasitic flatworms [phylum Platyhelminthes] and roundworms [phylum Nemata or Nematoda]).

Adult A. lumbricoides live in the lumen of the small intestine. A female may produce 200,000 eggs each day, which are passed with the feces of the host. Ingested unfertilized eggs are not infective, but fertile eggs begin to develop and become infective after 18 days to several weeks, depending on environmental conditions (an optimal environment being moist, warm, shaded soil). After infective eggs are swallowed, the larvae hatch, invade the intestinal mucosa, and are carried via first the portal and then the systemic circulation to the lungs. The larvae mature further in the lungs for 10 to 14 days, then penetrate the alveolar walls, ascend the bronchial tree to the throat, and are swallowed. Upon reaching the small intestine, they develop into adult worms. Between two and three months are required from ingestion of the infective eggs to oviposition (egg-laying) of the adult female. Adult worms can live one to two years.

Ascaris lumbricoides has a worldwide distribution, but is most prevalent in tropical and subtropical regions and areas with inadequate sanitation. In the United States, it occurs in rural regions of the southeastern U.S.

(Source: Centers for Disease Control Parasites and Health Website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Ascaris lumbricoides is a soil-transmitted helminth (parasitic) worm. It is common in tropical and sub-tropical regions and causes a disease called ascariasis.People become infected when they ingest worm eggs from soil.It lives and reproduces inside its human host.The worm cleverly works its way through the body from the gut, via the liver and heart, to the lungs and back to the gut.Symptoms of the disease vary, and some people don’t even realise they are infected (they are 'asymptomatic').People infected with multiple worms experience diarrhoea, abdominal pain, general malaise and weakness. These symptoms can affect people’s ability to work and learn, and can impair physical growth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Size
Ascaris worms are very long. Adult females grow up to half a metre long, and males are15–31cm in length. They vary in diameter from 2–6mm.

Life cycle
  • ingested Ascaris eggs hatch out into larval worms in the intestine
  • worms pass through the intestine wall into the bloodstream
  • worms travel via the liver and heart into the lungs
  • after 3 weeks they are coughed up, swallowed and return to the gut
  • male and female worms mate and female worm produces eggs
  • eggs pass out in the stool and become infectious after 2 weeks in the soil
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Ascaris lumbricoides infections have been reported in more than 150 countries across the globe, particularly in tropic, subtropic and temperate regions. Approximately 1.4 billion people worldwide are infected, 4 million of whom live in the United States. As an obligate internal parasite of humans, Ascaris lumbricoides can theoretically be found wherever humans are present. The highly durable eggs can remain dormant in the soil for up to 10 years and are resistant to many adverse conditions.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian ; oceanic islands

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adults:  The roundworm Ascaris lumbricoides is the largest intestinal nematode infecting humans, with females averaging 30 cm in length (ranging from 20-49 cm) and measuring 3-6 mm in diameter. Males are smaller, ranging from 15-30 cm in length and 2-4 mm in diameter. Both sexes have an elongated, cylindrical body which tapers at both ends; in males the tail curves ventrally. In addition to size, sexes may be differentiated by the vulval opening in females, located ventrally at a point of constriction approximately one third of the body length from the anterior end, and by the papillae in males, grouped pre- and post-anally. Both sexes are cream-colored, sometimes with a pink tinge. The integument of the worm is a chitinous layer of nonnucleated cuticula with circular striations. A. lumbricoides lacks circular muscles, the only muscle bands being longitudinal, and the worm uses muscular activity to remain in the intestinal lumen of the host. This roundworm also lacks a circulatory system and its digestive, excretory, nervous and reproductive systems are all suspended within the pseudocoelom.

There are three forms of eggs: fertilized, decorticate and unfertilized. Fertilized eggs are golden brown in color and ovoid in shape, measuring 30-40 μm by 50-60 μm. The egg is termed decorticate if the thick, external mamillated layer is absent. Unfertilized eggs are larger (reaching 90 μm in length) and more elongated in shape, have a thinner shell and are poorly organized internally, being a mass of variably sized granules.

Range length: 20 to 49 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The roundworm, Ascaris lumbricoides is an obligate internal parasite and adults usually reside in the small intestine of humans, specifically the jejunum. The worm produces a pepsin inhibitor to prevent host enzymes from digesting it and uses muscular activity to avoid being excreted. The life cycle involves no free-living stages or intermediate hosts, although fertilized eggs require up to 3 weeks of embryonation in soil before becoming infective and can survive for up to 10 years in soil under warm, moist conditions. As part of the life cycle, larva briefly migrate via the circulatory and lymphatic systems through the liver, heart and lungs. Rarely the worms may migrate to other regions of the body including the appendix, pancreas, kidneys or brain. Temporary infections can be induced in other mammals (rodents), but following migration through the liver and lungs the larvae are expelled from the intestine.

Habitat Regions: temperate ; tropical ; terrestrial

Other Habitat Features: urban ; suburban ; agricultural

  • Baron, S., G. Castro, D. Wakelin, J. Cross. 1996. Medical Microbiology. Galveston, Texas: The University of Texas Medical Branch of Galveston. Accessed March 19, 2011 at http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=mmed&part=Section4.bxml.
  • Bethony, J., S. Brooker, M. Albonico, S. Geiger, A. Loukas, D. Diemert, P. Hotez. 2006. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. The Lancet, 367 (9521): 1521-1532. Accessed March 19, 2011 at http://www.thelancet.com/journals/lancet/article/PIIS0140-6736(06)68653-4/fulltext.
  • Crompton, D. 1988. The prevalence of ascariasis. Parasitology Today, Volume 4 Issue 6: 162-169.
  • Sprent, J. 1952. On the migratory behavior of the larvae of various Ascaris species in white mice: I. Distribution in tissues. The Journal of Infectious Diseases, 90 (2): 165-176.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Ascaris lumbricoides uses feeds in the human intestine liquid contents flow past.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ascaris lumbricoides is the most common intestinal parasite of humans. It has no known predators or other hosts, although the closely related species A. suum is a parasite of pigs.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ascaris lumbricoides has no known predators while inside the host, nor outside it as there are no free-living stages. The eggs are eaten by the host but are usually ingested accidentally (the only exception being in the case of laboratory experiments in which doses are purposefully administered to subjects).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Nematodes have limited visual abilities, instead relying on chemosensory interactions to find mates and food and to orient themselves inside the host. Specifically, the females release sex pheromones to attract males. Roundworms also possess papillae, used for tactile sensation and particularly employed in copulation. However, no specific information is known regarding communication and perception in Ascaris lumbricoides.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Infection
People become infected with Ascaris worms when they ingest Ascaris eggs.This can happen when:
  • children play in soil which contains Ascaris eggs
  • people consume food or water which is contaminated with eggs
  • people eat soil - this is common is some communities


Signs and symptoms
Some people with Ascaris infections are asymptomatic. The severity of disease depends on how many worms are living in the gut.Chronic Ascaris infections can cause:
  • diarrhoea
  • abdominal pain
  • malnutrition
  • intestinal obstruction - this is extremely serious
  • stunted growth
  • learning difficulties


Disease control
Efforts to control ascariasis include:
  • improving sanitation, for example making sure latrines are available
  • mass distribution of deworming drugs


Treatment
The World Health Organisation recommends these drugs for treatment of ascariasis:
  • Albendazole
  • Mebendazole
  • Levamisole
  • Pyrantel


Museum research
Scientists are researching Ascaris worms and the people they infect to determine:
  • who is infected
  • how people respond to treatment
  • how the disease is spread
  • whether the same worms can infect humans and pigs
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Ascaris lumbricoides develops from egg to adult through four larval stages, each followed by a molt in which the cuticle is shed. Noninfective eggs are expelled from the host intestine and into the soil where they embryonate in approximately 3 weeks, given warm, moist conditions. At this stage they are infective, and once ingested, the infective eggs hatch in the duodenum. The larva then penetrate through the intestinal mucosa and enter the lymphatic and circulatory systems, migrating through the liver to the heart and lungs. From the lungs they migrate up the trachea, upon which the host coughs the larva up into the mouth and then swallows them, returning them to the small intestine. The entire migration takes several days, during which time the larva molts. The adult stage is reached 2-3 weeks post-infection and 8-12 weeks after infection the worms reach sexual maturity.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The adult stage is reached 8-12 weeks after being ingested by a human host, and adults live for approximately a year.

Range lifespan

Status: wild:
6 to 18 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male nematodes use chemotaxis to locate females. They have no visual abilities, and instead are attracted to specific sex pheromones which females release. Once the male has located a mate, it uses copulatory accessories such as papillae, spicules and its curved tail to direct sperm and stabilize the female during mating. There is no evidence of post-copulatory behaviors such as mate-guarding, although males of other species of nematode have been observed to secrete copulatory plugs into the vulva to prevent other males from fertilizing the same female. However, no information was found regarding the specific mating systems of Ascaris lumbricoides.

Ascaris lumbricoides is dioecious and copulation between individuals of opposite sexes is necessary for fertilization, and some evidence suggests pheromones play a role in mating. Males possess two testes and a curved posterior end with spicules for copulation. Females possess ovaries which are continuous with an oviduct and a tubular uterus; the uteri join to form a vagina which opens into the vulva. Sperm is transferred into the vulva of the female, enters the ovum and forms a zygote. The zygote then secretes a fertilization membrane which thickens to form the chitinous shell that protects the egg when it is expelled from the host. Females have been shown to lay as many as 234,000 eggs per day, and this daily egg output implies year-round mating with no specific breeding season. The eggs can survive in the soil for some time, and the larvae require 8-12 weeks after ingestion to reach reproductive maturity.

Range number of offspring: 234,000 eggs laid daily (high) .

Average number of offspring: 200,000 eggs laid daily.

Range age at sexual or reproductive maturity (female): 8 to 12 weeks.

Range age at sexual or reproductive maturity (male): 8 to 12 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Ascaris lumbricoides exhibits no parental care of offspring. The large fecundity of females (they produce about 200,000 eggs daily), the unusual resistance of the eggs themselves and the lack of free living stages ensures that some eggs will be ingested by a host and survive to reach reproductive maturity.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ascaris lumbricoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTAGGGGTTTTTATAGATATCAAGGTGGGTTGTCTGTTTGATTGGAAAGTTCTAATCATAAGGATATTGGTACTTTGTATTTTTTGTTTGGTTTGTGGTCTGGTATGGTTGGTACTAGGTTGTCTTTGGTGATTCGTTTGGAATTGGCTAAACCTGGTCTTCTTTTGGGTAGTGGTCAGTTATATAATTCTGTTATTACTGCGCATGCTATTTTGATGATTTTTTTTATGGTTATACCTACTATGATTGGTGGTTTTGGTAATTGAATGTTGCCTTTGATGTTGGGGGCTCCTGATATGAGTTTTCCTCGTTTAAATAATTTAAGTTTTTGGTTGTTGCCTACTGCTATGTTTTTAATTTTGGATGCTTGTTTTGTTGATATGGGTTGTGGTACTAGTTGGACTGTTTACCCTCCTTTGAGTACTATGGGTCATCCTGGTGGTAGGGTTGATCTTGCTATTTTTAGTTTGCATTGTGCTGGGGTTAGATCTATTTTGGGTGCTATTAATTTTATGACTACTACTAAGAATTTGCGTAGTAGTTCTATTTCTTTGGAACATATGAGTTTGTTTGTTTGGACTGTTTTTGTTACTGTTTTTTTGTTGGTTTTGTCTTTACCTGTTTTGGCTGGGGCTATTACTATGTTGTTAACTGATCGTAATCTTAATACTTCTTTTTTTGATCCTAGGACTGGTGGTAACCCTTTGATTTATCAACATTTATTTTGGTTTTTTGGTCATCCTGAGGTTTATATTTTGATTTTACCAGCTTTTGGTATTATTAGTCAGAGTAGTTTGTATTTGACTGGTAAAAAGGAGGTTTTTGGGTCTTTGGGTATGGTTTATGCTATTTTAAGTATTGGTTTGATTGGTTGTGTTGTTTGAGCTCATCATATGTATACTGTTGGTATGGATCTTGATTCTCGGGCTTATTTTACTGCTGCAACTATGGTTATTGCTGTTCCTACTGGTGTTAAGGTTTTTAGTTGGTTGGCTACCTTGTTTGGTATAAAAATGGTTTTTCAGCCTTTACTTTTATGAGTTATGGGTTTTATTTTTTTGTTTACTATTGGTGGGTTAACCGGGGTTATACTTTCTAATTCTAGTTTGGATATTATCTTGCATGATACTTATTATGTTGTTAGTCATTTTCATTATGTTCTTAGTTTGGGGGCTGTTTTTGGTATTTTTACGGGTGTGACTTTGTGGTGAAGTTTTATTACTGGTTTTGCTTATGATAAGATGATGATGAGAAGTGTTTTTTTTTTAATGTTTGTTGGGGTTAATTTAACTTTTTTTCCTTTACATTTTGCTGGTATTCATGGCTATCCTCGTAAGTATTTGGATTATCCTGATGTTTATTCTGTTTGAAATATTATGGCTTCTTATGGGTCTATAATTAGTGTGTTTGCTTTGTTTTTGTTTATTTATGTTTTGTTAGAGTCTTTTGTGGGTCATCGTATTTTTTTGTTTGATTATTATGTAAATAGTGGTCCTGAGTATAGTCTTAGTGGTTATGTTTTTGGTCATAGTTACCAGTCTGAGATTTTTTATAGGTCTATTGTTTTTAAGTTTTAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ascaris lumbricoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Ascaris lumbricoides is the most common multicellular intestinal parasite of humans, found in over 150 countries worldwide.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Ascaris lumbricoides infects approximately 1.4 billion people in over 150 countries worldwide, and is estimated to infect anywhere from one fourth to one third of the global population. In 2001, an estimate of disability-adjusted life years due to Ascaris lumbricoides was 1-2 years. This roundworm contributes significantly to the burden of abdominal surgical emergencies, as the rate of complications from infection can be as high as 67%, primarily due to intestinal and biliary tract obstruction. Infection is rarely fatal, but because of its high prevalence it is still responsible for 8000-100,000 deaths annually. Infection with Ascaris lumbricoides is also an important cause of malnutrition, particularly in children, causing protein energy loss and vitamin A and C deficiencies. Overall, it can cause stunting of linear growth, leading to both physical and mental deficits.

Negative Impacts: injures humans (causes disease in humans )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No information was found regarding benefits to humans provided by Ascaris lumbricoides, but as an intestinal parasite it is unlikely that there are any.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!