Overview

Brief Summary

Ascaris lumbricoides is the largest nematode (roundworm) parasitizing the human intestine (adult females are 20 to 35 cm and adult males 15 to 30 cm in length). Infection with this parasite is known as ascariasis and is the most common helminthic infection in the world ("helminth" is a functional term, rather than a meaningful taxonomic one, referring to any worm-like internal parasite and used mainly to refer to parasitic flatworms [phylum Platyhelminthes] and roundworms [phylum Nemata or Nematoda]).

Adult A. lumbricoides live in the lumen of the small intestine. A female may produce 200,000 eggs each day, which are passed with the feces of the host. Ingested unfertilized eggs are not infective, but fertile eggs begin to develop and become infective after 18 days to several weeks, depending on environmental conditions (an optimal environment being moist, warm, shaded soil). After infective eggs are swallowed, the larvae hatch, invade the intestinal mucosa, and are carried via first the portal and then the systemic circulation to the lungs. The larvae mature further in the lungs for 10 to 14 days, then penetrate the alveolar walls, ascend the bronchial tree to the throat, and are swallowed. Upon reaching the small intestine, they develop into adult worms. Between two and three months are required from ingestion of the infective eggs to oviposition (egg-laying) of the adult female. Adult worms can live one to two years.

Ascaris lumbricoides has a worldwide distribution, but is most prevalent in tropical and subtropical regions and areas with inadequate sanitation. In the United States, it occurs in rural regions of the southeastern U.S.

(Source: Centers for Disease Control Parasites and Health Website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Ascaris lumbricoides is a soil-transmitted helminth (parasitic) worm. It is common in tropical and sub-tropical regions and causes a disease called ascariasis.People become infected when they ingest worm eggs from soil.It lives and reproduces inside its human host.The worm cleverly works its way through the body from the gut, via the liver and heart, to the lungs and back to the gut.Symptoms of the disease vary, and some people don’t even realise they are infected (they are 'asymptomatic').People infected with multiple worms experience diarrhoea, abdominal pain, general malaise and weakness. These symptoms can affect people’s ability to work and learn, and can impair physical growth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Size
Ascaris worms are very long. Adult females grow up to half a metre long, and males are15–31cm in length. They vary in diameter from 2–6mm.

Life cycle
  • ingested Ascaris eggs hatch out into larval worms in the intestine
  • worms pass through the intestine wall into the bloodstream
  • worms travel via the liver and heart into the lungs
  • after 3 weeks they are coughed up, swallowed and return to the gut
  • male and female worms mate and female worm produces eggs
  • eggs pass out in the stool and become infectious after 2 weeks in the soil
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Ascaris lumbricoides infections have been reported in more than 150 countries across the globe, particularly in tropic, subtropic and temperate regions. Approximately 1.4 billion people worldwide are infected, 4 million of whom live in the United States. As an obligate internal parasite of humans, Ascaris lumbricoides can theoretically be found wherever humans are present. The highly durable eggs can remain dormant in the soil for up to 10 years and are resistant to many adverse conditions.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian ; oceanic islands

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults:  The roundworm Ascaris lumbricoides is the largest intestinal nematode infecting humans, with females averaging 30 cm in length (ranging from 20-49 cm) and measuring 3-6 mm in diameter. Males are smaller, ranging from 15-30 cm in length and 2-4 mm in diameter. Both sexes have an elongated, cylindrical body which tapers at both ends; in males the tail curves ventrally. In addition to size, sexes may be differentiated by the vulval opening in females, located ventrally at a point of constriction approximately one third of the body length from the anterior end, and by the papillae in males, grouped pre- and post-anally. Both sexes are cream-colored, sometimes with a pink tinge. The integument of the worm is a chitinous layer of nonnucleated cuticula with circular striations. A. lumbricoides lacks circular muscles, the only muscle bands being longitudinal, and the worm uses muscular activity to remain in the intestinal lumen of the host. This roundworm also lacks a circulatory system and its digestive, excretory, nervous and reproductive systems are all suspended within the pseudocoelom.

There are three forms of eggs: fertilized, decorticate and unfertilized. Fertilized eggs are golden brown in color and ovoid in shape, measuring 30-40 μm by 50-60 μm. The egg is termed decorticate if the thick, external mamillated layer is absent. Unfertilized eggs are larger (reaching 90 μm in length) and more elongated in shape, have a thinner shell and are poorly organized internally, being a mass of variably sized granules.

Range length: 20 to 49 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The roundworm, Ascaris lumbricoides is an obligate internal parasite and adults usually reside in the small intestine of humans, specifically the jejunum. The worm produces a pepsin inhibitor to prevent host enzymes from digesting it and uses muscular activity to avoid being excreted. The life cycle involves no free-living stages or intermediate hosts, although fertilized eggs require up to 3 weeks of embryonation in soil before becoming infective and can survive for up to 10 years in soil under warm, moist conditions. As part of the life cycle, larva briefly migrate via the circulatory and lymphatic systems through the liver, heart and lungs. Rarely the worms may migrate to other regions of the body including the appendix, pancreas, kidneys or brain. Temporary infections can be induced in other mammals (rodents), but following migration through the liver and lungs the larvae are expelled from the intestine.

Habitat Regions: temperate ; tropical ; terrestrial

Other Habitat Features: urban ; suburban ; agricultural

  • Baron, S., G. Castro, D. Wakelin, J. Cross. 1996. Medical Microbiology. Galveston, Texas: The University of Texas Medical Branch of Galveston. Accessed March 19, 2011 at http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=mmed&part=Section4.bxml.
  • Bethony, J., S. Brooker, M. Albonico, S. Geiger, A. Loukas, D. Diemert, P. Hotez. 2006. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. The Lancet, 367 (9521): 1521-1532. Accessed March 19, 2011 at http://www.thelancet.com/journals/lancet/article/PIIS0140-6736(06)68653-4/fulltext.
  • Crompton, D. 1988. The prevalence of ascariasis. Parasitology Today, Volume 4 Issue 6: 162-169.
  • Sprent, J. 1952. On the migratory behavior of the larvae of various Ascaris species in white mice: I. Distribution in tissues. The Journal of Infectious Diseases, 90 (2): 165-176.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Ascaris lumbricoides uses feeds in the human intestine liquid contents flow past.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Ascaris lumbricoides is the most common intestinal parasite of humans. It has no known predators or other hosts, although the closely related species A. suum is a parasite of pigs.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Ascaris lumbricoides has no known predators while inside the host, nor outside it as there are no free-living stages. The eggs are eaten by the host but are usually ingested accidentally (the only exception being in the case of laboratory experiments in which doses are purposefully administered to subjects).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Nematodes have limited visual abilities, instead relying on chemosensory interactions to find mates and food and to orient themselves inside the host. Specifically, the females release sex pheromones to attract males. Roundworms also possess papillae, used for tactile sensation and particularly employed in copulation. However, no specific information is known regarding communication and perception in Ascaris lumbricoides.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Infection
People become infected with Ascaris worms when they ingest Ascaris eggs.This can happen when:
  • children play in soil which contains Ascaris eggs
  • people consume food or water which is contaminated with eggs
  • people eat soil - this is common is some communities


Signs and symptoms
Some people with Ascaris infections are asymptomatic. The severity of disease depends on how many worms are living in the gut.Chronic Ascaris infections can cause:
  • diarrhoea
  • abdominal pain
  • malnutrition
  • intestinal obstruction - this is extremely serious
  • stunted growth
  • learning difficulties


Disease control
Efforts to control ascariasis include:
  • improving sanitation, for example making sure latrines are available
  • mass distribution of deworming drugs


Treatment
The World Health Organisation recommends these drugs for treatment of ascariasis:
  • Albendazole
  • Mebendazole
  • Levamisole
  • Pyrantel


Museum research
Scientists are researching Ascaris worms and the people they infect to determine:
  • who is infected
  • how people respond to treatment
  • how the disease is spread
  • whether the same worms can infect humans and pigs
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Ascaris lumbricoides develops from egg to adult through four larval stages, each followed by a molt in which the cuticle is shed. Noninfective eggs are expelled from the host intestine and into the soil where they embryonate in approximately 3 weeks, given warm, moist conditions. At this stage they are infective, and once ingested, the infective eggs hatch in the duodenum. The larva then penetrate through the intestinal mucosa and enter the lymphatic and circulatory systems, migrating through the liver to the heart and lungs. From the lungs they migrate up the trachea, upon which the host coughs the larva up into the mouth and then swallows them, returning them to the small intestine. The entire migration takes several days, during which time the larva molts. The adult stage is reached 2-3 weeks post-infection and 8-12 weeks after infection the worms reach sexual maturity.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The adult stage is reached 8-12 weeks after being ingested by a human host, and adults live for approximately a year.

Range lifespan

Status: wild:
6 to 18 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male nematodes use chemotaxis to locate females. They have no visual abilities, and instead are attracted to specific sex pheromones which females release. Once the male has located a mate, it uses copulatory accessories such as papillae, spicules and its curved tail to direct sperm and stabilize the female during mating. There is no evidence of post-copulatory behaviors such as mate-guarding, although males of other species of nematode have been observed to secrete copulatory plugs into the vulva to prevent other males from fertilizing the same female. However, no information was found regarding the specific mating systems of Ascaris lumbricoides.

Ascaris lumbricoides is dioecious and copulation between individuals of opposite sexes is necessary for fertilization, and some evidence suggests pheromones play a role in mating. Males possess two testes and a curved posterior end with spicules for copulation. Females possess ovaries which are continuous with an oviduct and a tubular uterus; the uteri join to form a vagina which opens into the vulva. Sperm is transferred into the vulva of the female, enters the ovum and forms a zygote. The zygote then secretes a fertilization membrane which thickens to form the chitinous shell that protects the egg when it is expelled from the host. Females have been shown to lay as many as 234,000 eggs per day, and this daily egg output implies year-round mating with no specific breeding season. The eggs can survive in the soil for some time, and the larvae require 8-12 weeks after ingestion to reach reproductive maturity.

Range number of offspring: 234,000 eggs laid daily (high) .

Average number of offspring: 200,000 eggs laid daily.

Range age at sexual or reproductive maturity (female): 8 to 12 weeks.

Range age at sexual or reproductive maturity (male): 8 to 12 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Ascaris lumbricoides exhibits no parental care of offspring. The large fecundity of females (they produce about 200,000 eggs daily), the unusual resistance of the eggs themselves and the lack of free living stages ensures that some eggs will be ingested by a host and survive to reach reproductive maturity.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ascaris lumbricoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTAGGGGTTTTTATAGATATCAAGGTGGGTTGTCTGTTTGATTGGAAAGTTCTAATCATAAGGATATTGGTACTTTGTATTTTTTGTTTGGTTTGTGGTCTGGTATGGTTGGTACTAGGTTGTCTTTGGTGATTCGTTTGGAATTGGCTAAACCTGGTCTTCTTTTGGGTAGTGGTCAGTTATATAATTCTGTTATTACTGCGCATGCTATTTTGATGATTTTTTTTATGGTTATACCTACTATGATTGGTGGTTTTGGTAATTGAATGTTGCCTTTGATGTTGGGGGCTCCTGATATGAGTTTTCCTCGTTTAAATAATTTAAGTTTTTGGTTGTTGCCTACTGCTATGTTTTTAATTTTGGATGCTTGTTTTGTTGATATGGGTTGTGGTACTAGTTGGACTGTTTACCCTCCTTTGAGTACTATGGGTCATCCTGGTGGTAGGGTTGATCTTGCTATTTTTAGTTTGCATTGTGCTGGGGTTAGATCTATTTTGGGTGCTATTAATTTTATGACTACTACTAAGAATTTGCGTAGTAGTTCTATTTCTTTGGAACATATGAGTTTGTTTGTTTGGACTGTTTTTGTTACTGTTTTTTTGTTGGTTTTGTCTTTACCTGTTTTGGCTGGGGCTATTACTATGTTGTTAACTGATCGTAATCTTAATACTTCTTTTTTTGATCCTAGGACTGGTGGTAACCCTTTGATTTATCAACATTTATTTTGGTTTTTTGGTCATCCTGAGGTTTATATTTTGATTTTACCAGCTTTTGGTATTATTAGTCAGAGTAGTTTGTATTTGACTGGTAAAAAGGAGGTTTTTGGGTCTTTGGGTATGGTTTATGCTATTTTAAGTATTGGTTTGATTGGTTGTGTTGTTTGAGCTCATCATATGTATACTGTTGGTATGGATCTTGATTCTCGGGCTTATTTTACTGCTGCAACTATGGTTATTGCTGTTCCTACTGGTGTTAAGGTTTTTAGTTGGTTGGCTACCTTGTTTGGTATAAAAATGGTTTTTCAGCCTTTACTTTTATGAGTTATGGGTTTTATTTTTTTGTTTACTATTGGTGGGTTAACCGGGGTTATACTTTCTAATTCTAGTTTGGATATTATCTTGCATGATACTTATTATGTTGTTAGTCATTTTCATTATGTTCTTAGTTTGGGGGCTGTTTTTGGTATTTTTACGGGTGTGACTTTGTGGTGAAGTTTTATTACTGGTTTTGCTTATGATAAGATGATGATGAGAAGTGTTTTTTTTTTAATGTTTGTTGGGGTTAATTTAACTTTTTTTCCTTTACATTTTGCTGGTATTCATGGCTATCCTCGTAAGTATTTGGATTATCCTGATGTTTATTCTGTTTGAAATATTATGGCTTCTTATGGGTCTATAATTAGTGTGTTTGCTTTGTTTTTGTTTATTTATGTTTTGTTAGAGTCTTTTGTGGGTCATCGTATTTTTTTGTTTGATTATTATGTAAATAGTGGTCCTGAGTATAGTCTTAGTGGTTATGTTTTTGGTCATAGTTACCAGTCTGAGATTTTTTATAGGTCTATTGTTTTTAAGTTTTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ascaris lumbricoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Ascaris lumbricoides is the most common multicellular intestinal parasite of humans, found in over 150 countries worldwide.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ascaris lumbricoides infects approximately 1.4 billion people in over 150 countries worldwide, and is estimated to infect anywhere from one fourth to one third of the global population. In 2001, an estimate of disability-adjusted life years due to Ascaris lumbricoides was 1-2 years. This roundworm contributes significantly to the burden of abdominal surgical emergencies, as the rate of complications from infection can be as high as 67%, primarily due to intestinal and biliary tract obstruction. Infection is rarely fatal, but because of its high prevalence it is still responsible for 8000-100,000 deaths annually. Infection with Ascaris lumbricoides is also an important cause of malnutrition, particularly in children, causing protein energy loss and vitamin A and C deficiencies. Overall, it can cause stunting of linear growth, leading to both physical and mental deficits.

Negative Impacts: injures humans (causes disease in humans )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No information was found regarding benefits to humans provided by Ascaris lumbricoides, but as an intestinal parasite it is unlikely that there are any.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ascaris lumbricoides

Ascaris lumbricoides is the giant roundworm of humans, belonging to the phylum Nematoda. An ascarid nematode, it is responsible for the disease ascariasis in humans, and it is the largest and most common parasitic worm in humans. One sixth of the human population is estimated to be infected by Ascaris lumbricoides or another roundworm .[1] Ascariasis is prevalent worldwide and more so in tropical and subtropical countries.

It can reach a length of up to 35 cm.[2]

Contents

Life cycle

Ascaris lumbricoides, or "roundworm", infections in humans occur when an ingested fertilised egg becomes a larval worm that penetrates the wall of the duodenum and enters the blood stream. From here, it is carried to the liver and heart, and enters pulmonary circulation to break free in the alveoli, where it grows and molts. In 3 weeks, the larvae pass from the respiratory system to be coughed up, swallowed, and thus returned to the small intestine, where they mature to adult male and female worms. Fertilization can now occur and the female produces as many as 200,000 eggs per day for a year. These fertilized eggs become infectious after 2 weeks in soil; they can persist in soil for 10 years or more.[3]

The eggs have a lipid layer, that makes them resistant to the effects of acids and alkalis as well as other chemicals. This resilience helps to explain why this nematode is such a ubiquitous parasite.[4]

Morphology

Fertile egg as can be seen in a microscope
Fertile egg in human faeces (detail)
Infertile egg

Ascaris lumbricoides is characterized by its great size. Males are 2–4 mm in diameter and 15–31 cm long. The males' posterior end is curved ventrally and has a bluntly pointed tail. Females are 3–6 mm wide and 20–49 cm long. The vulva is located in the anterior end and accounts for about a one third of its body length. Uteri may contain up to 27 million eggs at a time with 200,000 being laid per day. Fertilized eggs are oval to round in shape and are 45-75 micrometers long and 35-50 micrometers wide with a thick outer shell. Unfertilized eggs measure 88-94 micrometers long and 44 micrometers wide.[5]

Epidemiology

More than 2 billion people are affected by this infection.[3] In the United States there is a reported prevalence of 0.8% of the total population as of 1987. Ascaris lumbricoides eggs are extremely resistant to strong chemicals, desiccation, and low temperatures. The eggs can remain viable in the soil for several months or even years.[5]

Eggs of A. lumbricoides have been identified in archeological coprolites in the Americas, Europe, Africa, the Middle East, and New Zealand, the oldest ones being more than 24,000 years old.[6]

Infections

Infections with these parasites are more common where sanitation is poor[7] and raw human feces are used as fertilizer.

Symptoms

Often, there are no symptoms with an A. lumbricoides infection. However, in the case of a particularly bad infection, symptoms may include bloody sputum, cough, fever, abdominal discomfort, passing worms, etc.[8][9]

Prevention

Preventing any fecal-borne disease requires educated hygienic habits/culture and fecal treatment systems once a year. This is particularly important with ascaris because its eggs are one of the most difficult pathogens to kill (second only to prions), and the eggs commonly survive 1–3 years. Ascaris lives in the intestine where it lays eggs. Infection occurs when the eggs, too small to be seen by the unaided eye, are eaten. The eggs may get onto vegetables when improperly processed human feces of infected people are used as fertilizer for food crops. Infection may occur when food is handled without removing or killing the eggs on the hands, clothes, hair, raw vegetables/fruit, or cooked food that is (re)infected by handlers, containers, etc. Bleach does not readily kill Ascaris eggs but it will remove their sticky film, to allow the eggs to be rinsed away. Ascaris eggs can be reduced by hot composting methods, but to completely kill them may require rubbing alcohol, iodine, specialized chemicals, cooking heat, or "unusually" hot composting (for example, over 120 degrees Fahrenheit for 24 hours [1]).

Details of infection process

Infections happen when a human swallows water or food contaminated with unhatched juveniles. The juveniles hatch in the duodenum (1st section of small intestine). They then penetrate the mucosa and submucosa and enter venules or lymphatics. Next they pass through the right heart and into pulmonary circulation. They then break out of the capillaries and enter the air spaces. Acute tissue reaction occurs when several worms get lost during this migration and accumulate in other organs of the body. The juveniles migrate from the lung up the respiratory tract to the pharynx where they are swallowed. They begin producing eggs within 60–65 days of being swallowed. These are produced within the small intestine where the juveniles mature. It might seem odd that the worms end up in the same place where they began. One hypothesis to account for this behavior is that the migration mimics an intermediate host, which would be required for juveniles of an ancestral form to develop to the third stage. Another possibility is that tissue migration enables faster growth and larger size, which increases reproductive capacity.[10]

Diagnosis and treatment

Most diagnoses are made by identifying the appearance of the worm or eggs in feces. Due to the large quantity of eggs laid, physicians can diagnose using only one or two fecal smears.

Infections can be treated with drugs called ascaricides. The treatment of choice is Mebendazole. The drug functions by binding to tubulin in the worms' intestinal cells and body-wall muscles. Nitazoxanide and ivermectin can also be used.[5]

References

  1. ^ Harhay MO, Horton J, Olliaro PL (February 2010). "Epidemiology and control of human gastrointestinal parasites in children". Expert Review of Anti-infective Therapy 8 (2): 219–34. doi:10.1586/eri.09.119. PMC 2851163. PMID 20109051. 
  2. ^ "eMedicine - Ascaris Lumbricoides : Article by Aaron Laskey". Archived from the original on 27 January 2008. Retrieved 2008-02-03. 
  3. ^ a b Murray, Patrick R.; Rosenthal, Ken S.; Pfaller, Michael A. Medical Microbiology, Fifth Edition. United States: Elsevier Mosby, 2005
  4. ^ Piper R (2007). Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
  5. ^ a b c Roberts, Larry S.; Janovy, John Jr. Foundations of Parasitology, Eight Edition. United States: McGraw-Hill, 2009
  6. ^ Dridelle R. Parasites. Tales of Humanity's Mostly Unwelcome Guests. Univ. of California, 2010. p. 26. ISBN 978-0-520-25938-6. 
  7. ^ "DPDx - Ascariasis". Archived from the original on 24 February 2008. Retrieved 2008-02-03. 
  8. ^ http://www.nlm.nih.gov/medlineplus/ency/article/000628.htm
  9. ^ http://www.stanford.edu/group/parasites/ParaSites2005/Ascaris/JLora_ParaSite.htm#Symptoms
  10. ^ Read, A.F.; Skorping, A. 1995. The Evolution of Tissue Migration by Parasitic Nematode Larvae. Parasitology 111:359-371
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!