Molecular Biology and Genetics

Molecular Biology

Barcode data: Olethreutes arcuella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGTAACTGATTAGTACCTCTAATATTGGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTATTATACTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATCGCCCATAGTGGTAGATCTGTGGATCTTGCTATCTTTTCTTTACATTTAGCCGGAATTTCATCAATTTTAGGAGCTGTTAATTTTATTACAACCATCATTAACATACGACCTAATAATATATCATTAGATCAAATACCCTTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTACTCCTTTCTCTACCTGTATTAGCAGGAGCTATTACAATATTACTAACTGATCGAAACCTTAATACATCATTTTTTGATCCAGCAGGTGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Olethreutes arcuella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Olethreutes arcuella

Olethreutes arcuella, the Arched Marble, is a colorful small moth species of the family Tortricidae. It is found in the Palearctic ecozone.

The adults' wingspan is 14–18 mm. The caterpillars feed on dead and dried out leaves and similar plant material.[1]

Synonyms[edit]

Junior synonyms of this species are:[2]

  • Olethreutes arcuellus (lapsus)
  • Phalaena arcuana Linnaeus, 1761
  • Phalaena arcuella Clerck, 1759
  • Phalaena lambergiana Scopoli, 1763
  • Tortrix arcuana (Linnaeus, 1761)

Footnotes[edit]

  1. ^ Grabe (1942)
  2. ^ Baixeras et al. (2009), and see references in Savela (2005)

References[edit]

  • Baixeras, J.; Brown, J.W. & Gilligan, T.M. (2009): Online World Catalogue of the TortricidaeOlethreutes arcuella. Version 1.3.1. Retrieved 2010-APR-19.
  • Grabe, Albert (1942): Eigenartige Geschmacksrichtungen bei Kleinschmetterlingsraupen ["Strange tastes among micromoth caterpillars"]. Zeitschrift des Wiener Entomologen-Vereins 27: 105-109 [in German]. PDF fulltext
  • Savela, Markku (2005): Markku Savela's Lepidoptera and some other life forms – Olethreutes arcuellus [sic]. Version of 2005-SEP-16. Retrieved 2010-APR-19.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!