Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Olethreutes arcuella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Olethreutes arcuella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGTAACTGATTAGTACCTCTAATATTGGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTATTATACTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATCGCCCATAGTGGTAGATCTGTGGATCTTGCTATCTTTTCTTTACATTTAGCCGGAATTTCATCAATTTTAGGAGCTGTTAATTTTATTACAACCATCATTAACATACGACCTAATAATATATCATTAGATCAAATACCCTTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTACTCCTTTCTCTACCTGTATTAGCAGGAGCTATTACAATATTACTAACTGATCGAAACCTTAATACATCATTTTTTGATCCAGCAGGTGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Olethreutes arcuella

Olethreutes arcuella is a colorful small moth species of the family Tortricidae. It is found in the Palearctic ecozone.

The adults' wingspan is 14–18 mm. The caterpillars feed on dead and dried out leaves and similar plant material.[1]

Synonyms[edit]

Junior synonyms of this species are:[2]

  • Olethreutes arcuellus (lapsus)
  • Phalaena arcuana Linnaeus, 1761
  • Phalaena arcuella Clerck, 1759
  • Phalaena lambergiana Scopoli, 1763
  • Tortrix arcuana (Linnaeus, 1761)

Footnotes[edit]

  1. ^ Grabe (1942)
  2. ^ Baixeras et al. (2009), and see references in Savela (2005)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!