Table of Contents
Overview
Comprehensive Description
Biology
Inhabits coastal and inner reef sand flats and slopes, often in large lagoons (Ref. 48637). Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as V. longipinnis. Occurs in pairs or small groups and has been observed in burrows. Monogamous (Ref. 52884). Observed to rock back and forth when moving near the burrow.
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
© FishBase
Source:
FishBase
Trusted
Distribution
Indo-Pacific: Ashmore Reef, Maldives, and Seychelles to Oceania, north to Ryukyu Islands, south to the Great Barrier Reef.
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
© FishBase
Source:
FishBase
Trusted
Seychelles
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Morphology
Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
© FishBase
Source:
FishBase
Trusted
Size
Max. size
10.0 cm SL (male/unsexed; (Ref. 48637))
-
Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
http://www.fishbase.org/references/FBRefSummary.php?id=48637&speccode=4748
© FishBase
Source:
FishBase
Trusted
Diagnostic Description
Description
Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as @V. longipinnis@@. Occurs in pairs or small groups and has been observed in burrows. Observed to rock back and forth when moving near the burrow.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Type Information
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 168231
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Ragay Gulf, Canmahala Bay; Between Burias and Luzon, Luzon, Philippines, Philippine Archipelago, Canmahala Bay, Ragay Gulf, Pacific
Vessel: Albatross
Catalog Number: USNM 168231
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Ragay Gulf, Canmahala Bay; Between Burias and Luzon, Luzon, Philippines, Philippine Archipelago, Canmahala Bay, Ragay Gulf, Pacific
Vessel: Albatross
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258662
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Collette
Year Collected: 1970
Locality: New Guinea**Madang Harbour, Inside S.Tip Paeowai Island. Pile Of branching coral About 12 Ft. Across depth: 30-35 Ft.Gear: Rotenone, Papua New Guinea, Pacific
Depth (m): 9 to 11
Catalog Number: USNM 258662
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Collette
Year Collected: 1970
Locality: New Guinea**Madang Harbour, Inside S.Tip Paeowai Island. Pile Of branching coral About 12 Ft. Across depth: 30-35 Ft.Gear: Rotenone, Papua New Guinea, Pacific
Depth (m): 9 to 11
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 216335
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, M. Cameron & P. Woodhead
Year Collected: 1966
Locality: One Tree Islet, Australia, Queensland, Lagoon Side ( One Tree Island Side) of Reef, Flat Barrier To Sand Bank One Mile NNW of One Tree Island, One Tree Island, Capricorn Group, Queensland, Australia, Pacific
Depth (m): 5
Catalog Number: USNM 216335
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, M. Cameron & P. Woodhead
Year Collected: 1966
Locality: One Tree Islet, Australia, Queensland, Lagoon Side ( One Tree Island Side) of Reef, Flat Barrier To Sand Bank One Mile NNW of One Tree Island, One Tree Island, Capricorn Group, Queensland, Australia, Pacific
Depth (m): 5
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258661
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia: Queensland, Endeavour Reef; Off Western Tip of Southern Edge of Eastern Half of Reef. 200 Ft. From Reef Edge., Queensland, Australia, Pacific
Depth (m): 11 to 15
Catalog Number: USNM 258661
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia: Queensland, Endeavour Reef; Off Western Tip of Southern Edge of Eastern Half of Reef. 200 Ft. From Reef Edge., Queensland, Australia, Pacific
Depth (m): 11 to 15
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258660
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia, Queensland, Endeavour Reef, Middle of Western Edge of Western Half of Reef., Australia, Queensland, Pacific
Depth (m): 8 to 18
Catalog Number: USNM 258660
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia, Queensland, Endeavour Reef, Middle of Western Edge of Western Half of Reef., Australia, Queensland, Pacific
Depth (m): 8 to 18
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Canmahala Bay; Between Burias and Luzon, Luzon, Philippines, Canmahala Bay, Ragay Gulf, Pacific
Depth (m): 1 to 9
Vessel: Albatross
Catalog Number: USNM 258664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Canmahala Bay; Between Burias and Luzon, Luzon, Philippines, Canmahala Bay, Ragay Gulf, Pacific
Depth (m): 1 to 9
Vessel: Albatross
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258651
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia: Queensland, Endeavour Reef; Western End of Eastern Half of Reef; South Side., Australia, Queensland, Pacific
Depth (m): 14 to 15
Catalog Number: USNM 258651
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia: Queensland, Endeavour Reef; Western End of Eastern Half of Reef; South Side., Australia, Queensland, Pacific
Depth (m): 14 to 15
- Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Ecology
Habitat
Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.
Environmental ranges
Depth range (m): 1 - 15
Temperature range (°C): 24.659 - 29.336
Nitrate (umol/L): 0.094 - 1.049
Salinity (PPS): 33.845 - 35.373
Oxygen (ml/l): 4.389 - 4.825
Phosphate (umol/l): 0.073 - 0.231
Silicate (umol/l): 0.983 - 3.210
Graphical representation
Depth range (m): 1 - 15
Temperature range (°C): 24.659 - 29.336
Nitrate (umol/L): 0.094 - 1.049
Salinity (PPS): 33.845 - 35.373
Oxygen (ml/l): 4.389 - 4.825
Phosphate (umol/l): 0.073 - 0.231
Silicate (umol/l): 0.983 - 3.210
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 19 samples.
Environmental ranges
Depth range (m): 1 - 15
Temperature range (°C): 24.659 - 29.336
Nitrate (umol/L): 0.094 - 1.049
Salinity (PPS): 33.845 - 35.373
Oxygen (ml/l): 4.389 - 4.825
Phosphate (umol/l): 0.073 - 0.231
Silicate (umol/l): 0.983 - 3.210
Graphical representation
Depth range (m): 1 - 15
Temperature range (°C): 24.659 - 29.336
Nitrate (umol/L): 0.094 - 1.049
Salinity (PPS): 33.845 - 35.373
Oxygen (ml/l): 4.389 - 4.825
Phosphate (umol/l): 0.073 - 0.231
Silicate (umol/l): 0.983 - 3.210
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 1 - 15m.
From 1 to 15 meters.
Habitat: reef-associated. Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as @V. longipinnis@@. Occurs in pairs or small groups and has been observed in burrows. Observed to rock back and forth when moving near the burrow.
From 1 to 15 meters.
Habitat: reef-associated. Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as @V. longipinnis@@. Occurs in pairs or small groups and has been observed in burrows. Observed to rock back and forth when moving near the burrow.
© FishWise Professional
Source:
FishWise Professional
Trusted
Trophic Strategy
Inhabits patches of clean sand near coral heads.
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
© FishBase
Source:
FishBase
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Valenciennea parva
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CACCCTCTACCTAGTATTCGGTGCCTGAGCCGGAATGGTAGGCACAGCACTAAGCCTACTAATCCGGGCCGAACTTAGTCAACCCGGCGCATTACTGGGTGACGACCAAATTTACAATGTAATCGTAACCGCCCACGCATTCGTAATAATTTTCTTTATAGTAATGCCGATTATGATCGGAGGCTTTGGAAACTGGCTCATTCCACTTATGATTGGTGCCCCAGACATGGCATTTCCTCGAATAAATAATATGAGCTTTTGACTTCTCCCCCCGTCCTTCCTTCTTCTTCTAGCATCCTCTGGAGTAGAAGCCGGGGCAGGAACGGGATGAACTGTTTACCCGCCCTTAGCAGGCAACCTCGCACACGCAGGAGCATCTGTTGACTTAACAATCTTTTCTCTACATTTAGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCATTACAACAATCCTCAATATGAAACCTCCAGCCATTTCACAGTACCAGACTCCTTTATTTGTTTGGGCAGTTTTAATTACAGCAGTACTTCTTCTTCTGTCTCTGCCAGTTCTTGCTGCCGGGATCACAATGCTCCTAACAGACCGAAACTTAAATACCACCTTCTTTGACCCTGCAGGGGGAGGGACCCCCTTTCTTTACCAACATCT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Valenciennea parva
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
