Overview

Comprehensive Description

Biology

Inhabits coastal and inner reef sand flats and slopes, often in large lagoons (Ref. 48637). Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as V. longipinnis. Occurs in pairs or small groups and has been observed in burrows. Monogamous (Ref. 52884). Observed to rock back and forth when moving near the burrow.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Ashmore Reef, Maldives, and Seychelles to Oceania, north to Ryukyu Islands, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 53 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as @V. longipinnis@@. Occurs in pairs or small groups and has been observed in burrows. Observed to rock back and forth when moving near the burrow.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 168231
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Ragay Gulf, Canmahala Bay; Between Burias and Luzon, Luzon, Philippines, Philippine Archipelago, Canmahala Bay, Ragay Gulf, Pacific
Vessel: Albatross
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258662
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Collette
Year Collected: 1970
Locality: New Guinea**Madang Harbour, Inside S.Tip Paeowai Island. Pile Of branching coral About 12 Ft. Across depth: 30-35 Ft.Gear: Rotenone, Papua New Guinea, Pacific
Depth (m): 9 to 11
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 216335
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, M. Cameron & P. Woodhead
Year Collected: 1966
Locality: One Tree Islet, Australia, Queensland, Lagoon Side ( One Tree Island Side) of Reef, Flat Barrier To Sand Bank One Mile NNW of One Tree Island, One Tree Island, Capricorn Group, Queensland, Australia, Pacific
Depth (m): 5
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258661
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia: Queensland, Endeavour Reef; Off Western Tip of Southern Edge of Eastern Half of Reef. 200 Ft. From Reef Edge., Queensland, Australia, Pacific
Depth (m): 11 to 15
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258660
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia, Queensland, Endeavour Reef, Middle of Western Edge of Western Half of Reef., Australia, Queensland, Pacific
Depth (m): 8 to 18
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Canmahala Bay; Between Burias and Luzon, Luzon, Philippines, Canmahala Bay, Ragay Gulf, Pacific
Depth (m): 1 to 9
Vessel: Albatross
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Valenciennea parva Hoese & Larson
Catalog Number: USNM 258651
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Tyler & C. Smith
Year Collected: 1969
Locality: Australia: Queensland, Endeavour Reef; Western End of Eastern Half of Reef; South Side., Australia, Queensland, Pacific
Depth (m): 14 to 15
  • Paratype: Hoese, D. F. & Larson, H. K. 1994. Indo-Pacific Fishes. No. 23: 37.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 15 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 1 - 15
  Temperature range (°C): 24.659 - 29.336
  Nitrate (umol/L): 0.094 - 1.049
  Salinity (PPS): 33.845 - 35.373
  Oxygen (ml/l): 4.389 - 4.825
  Phosphate (umol/l): 0.073 - 0.231
  Silicate (umol/l): 0.983 - 3.210

Graphical representation

Depth range (m): 1 - 15

Temperature range (°C): 24.659 - 29.336

Nitrate (umol/L): 0.094 - 1.049

Salinity (PPS): 33.845 - 35.373

Oxygen (ml/l): 4.389 - 4.825

Phosphate (umol/l): 0.073 - 0.231

Silicate (umol/l): 0.983 - 3.210
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated. Found normally over clean, medium-grained sand patches interspersed with coral heads. It shares its habitat with the larger species such as @V. longipinnis@@. Occurs in pairs or small groups and has been observed in burrows. Observed to rock back and forth when moving near the burrow.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits patches of clean sand near coral heads.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea parva

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACCCTCTACCTAGTATTCGGTGCCTGAGCCGGAATGGTAGGCACAGCACTAAGCCTACTAATCCGGGCCGAACTTAGTCAACCCGGCGCATTACTGGGTGACGACCAAATTTACAATGTAATCGTAACCGCCCACGCATTCGTAATAATTTTCTTTATAGTAATGCCGATTATGATCGGAGGCTTTGGAAACTGGCTCATTCCACTTATGATTGGTGCCCCAGACATGGCATTTCCTCGAATAAATAATATGAGCTTTTGACTTCTCCCCCCGTCCTTCCTTCTTCTTCTAGCATCCTCTGGAGTAGAAGCCGGGGCAGGAACGGGATGAACTGTTTACCCGCCCTTAGCAGGCAACCTCGCACACGCAGGAGCATCTGTTGACTTAACAATCTTTTCTCTACATTTAGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCATTACAACAATCCTCAATATGAAACCTCCAGCCATTTCACAGTACCAGACTCCTTTATTTGTTTGGGCAGTTTTAATTACAGCAGTACTTCTTCTTCTGTCTCTGCCAGTTCTTGCTGCCGGGATCACAATGCTCCTAACAGACCGAAACTTAAATACCACCTTCTTTGACCCTGCAGGGGGAGGGACCCCCTTTCTTTACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea parva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!