Overview

Comprehensive Description

Biology

A secretive species that inhabits seaward reefs, among live coral or rubble (Ref. 1602). Benthic and benthopelagic (Ref. 58302). Often observed hiding around the base of small heads of live coral, especially Pocillopora meandrina. Stomach contents of specimens taken from Oahu and Johnston I. consisted of demersal eggs, copepods, amphipods, alpheid shrimp, crab megalops, larval shrimp and gastropod. However, it is likely that the copepods and larval food items are from demersal plankton because this species is never seen more than a few centimeters off the bottom (Ref. 33410).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western and Central Pacific, antiequatorial: Micronesia, Ogasawara Islands and Wake Island east to Hawaiian Islands; New Caledonia, Lau Group (Fiji) and Tonga east to Pitcairn Group, outh to Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Ocean: Japan to the Hawaiian and Tuamoto islands, south to the Austral Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from Japan to the Hawaiian and Tuamoto islands, and south to the Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 75 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113619
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at Yugui Island, west side of Island, ocean reef next to small boat passage., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Romurikku (Romuk) Island: coral heads on ocean side., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 1
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113617
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at Lomuilal Island, west side of Lomuilal Island. lagoon reef., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113618
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll, Mellu Island, lagoon reef near center of lagoon shore., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113598
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock, E. Herald, Donaldson, A. Welander, Potski & Bradner
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, isolated coral area 100 yds offshore of Airukiiji (Arji) Island; Bikini Atoll, lagoon side., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 12
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113601
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Chieerete (Cherry) Island, reef on ocean side, not in surf., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113597
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & V. Brock
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, reef on outer side of Bikini among scattered coral heads., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 1
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113616
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at Tufa Island, coral heads in lagoon side of island in 28 feet of water., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 9 to 9
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113606
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & V. Brock
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll: Bokororyuru (Boro) Island, Reef next to Bokororyuru (Boro) channel; area poisoned about 100x150 feet., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113605
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, outside reef of Yurochi (Code name: Yuro) Island-- near center of island; the Ilithothamnium ridge is about 1 mile out, so the station was run near the island in one of the deeper areas., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 5
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113602
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock, E. Herald & T. Kohler
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll at Amen Island, Station located 1/4 mile from shore in 30 feet of water (lagoon)., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 9
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113615
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at north end of Kieshiechi Island, lagoon side. A single coral head approximately 10 ft in diameter and 8 feet high (depth 20 feet)., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 6 to 6
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113600
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock & L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Coral heads in eastern end of lagoon at depth 20 to 25 feet., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 9
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113613
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll, Kabelle Island at north end, lagoon reef., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113596
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): E. Herald & V. Brock
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, at NW Section of Reer Island, lagoon reef., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Holotype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113603
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, outside reef of north end of Bokobyaadaa Island (Code: Boby). This station was located next to the island on the north side just before the sand spit curves out leading to Bokonejien Island to the north., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113604
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & V. Brock
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Eniirikku (Code= Erik) Island, at western end on ocean side- area 100 ft by 250 ft to 300., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 1
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113614
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at Naen Island, west side of Naen Island, lagoon reef., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 164420
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Gosline, J. Randall, Fong, Kop & Yount
Year Collected: 1952
Locality: T.H., Kona Coast of Hawaii In Kealakekua Bay, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113608
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz, V. Brock & R. Hiatt
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll: lagoon side reef halfway between Bikini and Amen Islands., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113607
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Bayer
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll, Bikini Island, reef on ocean side of Bikini Island., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 163223
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Ladd
Year Collected: 1952
Locality: Marshall Islands, Eniwetok Atoll, Bogan Island, Eniwetok Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113609
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz, V. Brock & R. Hiatt
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll, Namu Island, lagoon reef at east end of lithothamnium ridge., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113610
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz, V. Brock, R. Hiatt & G. Myers
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll, Eman Island, western end next to channel reef with only moderate growth of corals and algae., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113612
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz, V. Brock & L. Donaldson
Year Collected: 1947
Locality: Marshall Islands: Rongerik Atoll, Latoback Island in lagoon., Rongerik Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pseudocheilinus tetrataenia Schultz
Catalog Number: USNM 113611
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): University of Washington, Seattle
Year Collected: 1949
Locality: Likiep Island, Likiep Atoll, Ratak Chain, Marshall Islands, Pacific
  • Paratype: Schultz, L. P. 1960. Bulletin of the United States National Museum. No. 202: 167, fig. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 6 - 44m.
From 6 to 44 meters.

Habitat: reef-associated. A secretive species that inhabits seaward reefs, among live coral or rubble.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 6 - 44 m (Ref. 1602), usually 6 - 44 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits depths from 6-44 m. It is a secretive species that inhabits seaward reefs, among live coral or rubble. It is often observed hiding around the base of small heads of live coral, especially Pocillopora meandrina. Stomach contents of specimens taken from Oahu and Johnston I. consisted of demersal eggs, copepods, amphipods, alpheid shrimp, crab megalops, larval shrimp and gastropod. However, it is likely that the copepods and larval food items are from demersal plankton because this species is never seen more than a few centimeters off the bottom (Myers 1991, Randall 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 7 - 20
  Temperature range (°C): 25.075 - 26.159
  Nitrate (umol/L): 0.157 - 0.309
  Salinity (PPS): 35.265 - 35.550
  Oxygen (ml/l): 4.691 - 4.823
  Phosphate (umol/l): 0.092 - 0.158
  Silicate (umol/l): 1.384 - 1.837

Graphical representation

Depth range (m): 7 - 20

Temperature range (°C): 25.075 - 26.159

Nitrate (umol/L): 0.157 - 0.309

Salinity (PPS): 35.265 - 35.550

Oxygen (ml/l): 4.691 - 4.823

Phosphate (umol/l): 0.092 - 0.158

Silicate (umol/l): 1.384 - 1.837
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A secretive species that inhabits seaward reefs, among live coral or rubble (Ref. 1602). Often observed hiding around the base of small heads of live coral, especially Pocillopora meandrina. Stomach contents of specimens taken from Oahu and Johnston I. consisted of demersal eggs, copepods, amphipods, alpheid shrimp, crab megalops, larval shrimp and gastropod. However, it is likely that the copepods and larval food items are from demersal plankton because this species is never seen more than a few centimeters off the bottom (Ref. 33410).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocheilinus tetrataenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNTTAGTATTTGGTGCCTGAGCCGGTATAGTGGGCACAGCCCTAAGTTTACTCATCCGAGCGGAACTAAGTCAACCAGGGGCTCTCCTGGGCGACGACCAGATCTATAACGTAATTGTAACCGCACATGCTTTCGTAATGATCTTTTTTATGGTCATGCCAATCATGATTGGGGGGTTCGGAAACTGACTTATCCCGCTAATGATTGGTGCCCCCGATATGGCATTCCCCCGAATAAATAATATGAGCTTCTGGCTCCTCCCCCCTTCATTTCTTCTCCTACTTGCCTCGTCAGGCGTTGAAGCCGGGGCAGGAACAGGGTGAACGGTCTACCCCCCACTAGCAGGCAACCTAGCACACGCCGGGGCATCTGTAGACCTAACCATCTTCTCCCTCCACCTCGCGGGGATTTCTTCCATTCTTGGGGCTATTAACTTCATTACGACCATTATCAACATGAAACCCCCTGCCATCTCGCAATATCAAACCCCCCTATTCGTTTGAGCAGTCCTAATCACAGCTGTGCTCCTACTACTCTCTCTCCCAGTCCTTGCTGCTGGGATTACGATACTCCTGACAGACCGAAACCTCAACACCACATTCTTTGACCCTGCAGGAGGCGGAGACCCAATCTTTTACAACATCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocheilinus tetrataenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread. Although there is no population information for this species, there are no known major threats. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no known population information available for this species. This species is cryptic.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is occasionally collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pseudocheilinus tetrataenia

Pseudocheilinus tetrataenia is a Wrasse from the Pacific Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 7.5 cm in length.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!