Overview

Comprehensive Description

Biology

Inhabits among rubble or live corals of seaward reefs (Ref. 1602), usually in caves and crevices with rich invertebrate growth to at least 40 m depth (Ref. 48636). Benthopelagic (Ref. 58302). Feeds mainly on benthic crustaceans, but also takes small mollusks, echinoids (sea urchins) (Ref. 1602), fish eggs, and crab larvae (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Hawaiian and Ducie islands, north to the Yaeyama Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from East Africa to the Hawaiian and Ducie Islands, north to the Yaeyama Island, Japan and south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Mauritius, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Natal (South Africa), Madagascar and western Mascarenes east to Hawaiian Islands and Ducie (Pitcairn Group), north to Yaeyama Islands and Ogasawara Islands, south to Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 140 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Identified by the eight longitudinal lines along the body (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 50 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found from 2-50 m (Myers 1991). It occurs among rubble or live corals of seaward reefs, usually in caves and crevices with rich invertebrate growth. It feeds mainly on benthic crustaceans, but also takes small molluscs, echinoids (sea urchins), fish eggs, fish, copepods and crab larvae (Myers 1999, Randall 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 2.135 - 35
  Temperature range (°C): 23.718 - 28.954
  Nitrate (umol/L): 0.027 - 1.204
  Salinity (PPS): 34.131 - 35.550
  Oxygen (ml/l): 4.387 - 4.970
  Phosphate (umol/l): 0.054 - 0.351
  Silicate (umol/l): 0.906 - 3.680

Graphical representation

Depth range (m): 2.135 - 35

Temperature range (°C): 23.718 - 28.954

Nitrate (umol/L): 0.027 - 1.204

Salinity (PPS): 34.131 - 35.550

Oxygen (ml/l): 4.387 - 4.970

Phosphate (umol/l): 0.054 - 0.351

Silicate (umol/l): 0.906 - 3.680
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 50m.
From 2 to 50 meters.

Habitat: reef-associated. Inhabits among rubble or live corals of seaward reefs (Ref. 1602). Feeds mainly on benthic crustaceans, but also takes small molluscs and echinoids (sea urchins).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits among rubble or live corals of seaward reefs. Feeds mainly on benthic crustaceans, but also takes small molluscs, echinoids (sea urchins) (Ref. 1602), fish eggs, and crab larvae (Ref. 37816)..
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocheilinus octotaenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTGGTATTTGGTGCCTGAGCCGGGATGGTAGGCACAGCCCTAAGCCTTCTTATCCGAGCGGAGCTCAGCCAACCCGGGGCTCTCCTGGGGGACGATCAGATCTATAATGTTATTGTCACTGCGCATGCTTTCGTAATGATCTTTTTTATGGTCATGCCAATTATGATTGGGGGGTTTGGAAACTGGCTCATCCCACTAATGATTGGTGCCCCCGACATAGCATTCCCTCGAATGAACAATATGAGCTTTTGGCTTCTACCCCCCTCATTCCTTCTTCTCCTCGCCTCGTCTGGCGTTGAAGCTGGGGCCGGGACAGGTTGAACTGTCTATCCCCCTTTAGCTGGAAATCTGGCACACGCCGGAGCATCCGTGGATTTAACTATTTTCTCGCTTCACCTAGCAGGAATTTCTTCGATCCTCGGGGCTATTAACTTTATTACAACCATCATTAATATGAAACCCCCTGCCATCTCACAATATCAAACACCTCTGTTTGTTTGGGCAGTACTAATCACAGCAGTTCTTCTCCTACTTTCCCTCCCAGTCCTAGCTGCTGGAATTACAATACTCCTAACAGATCGAAATCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGGGACCCAATCCTGTACCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocheilinus octotaenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Sadovy, Y. & Rocha, L.A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and abundant throughout its range. There are no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no known population information available for this species. This species is abundant in many parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pseudocheilinus octotaenia

Pseudocheilinus octotaenia is a Wrasse from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 14 cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!