Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found among patches of rubble or among branching coral of seaward reef slopes from 6 to at least 40 m (Ref. 9710, 58302). Benthopelagic (Ref. 58302). Rare in less than 20 m (Ref. 1602). Generally solitary and feeds on small benthic invertebrates (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-West Pacific, from the Red Sea to South Africa, to Japan in the north and Australia to the west, and east to the Hawaiian and Marquesas Islands in the south (Parenti and Randall 2000). It is recorded in Seychelles, Pemba (Tanzania) and Aldabra Attoll. It is also recorded from Kimbe bay (Papua New Guine) (Hubble 2003), Solomon Islands (Allen 2006), Guadalcanal (Blaber et al. 1991), Shark Reef, Beqa Lagoon, (Fiji) and Kingdom of Tonga (Randall et al. 2003).

In the western Indian Ocean, it is recorded in Mozambique (Pereira 2000), Reunion Island (Letourneur et al. 2004) and the Jordanian Red Sea (Khalaf and Kchhzius 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa, Seychelles, Maldives and Chagos Archipelago to Midway and Hawaiian Islands, Tuamotu Archipelago and Marquesas Islands, north to Izu Islands (southern Japan), south to Rowley Shoals (Western Australia), Qu
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea to South Africa (Ref. 35918) and the Hawaiian and Tuamoto islands, north to the Izu Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11 - 13; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

A secretive species found among patches of rubble of seaward reef slopes from 6 to at least 40 m. Rare in less than 20 m (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body red to orange-red with about 25 fine white longitudinal lines; pale blue to bluish white streak from the mouth's corner to almost upper corner of preopercle. Interrupted lateral line, anterior tubed scales 14-17 (modally 16). Scales on cheek, 2 horizontal rows (3 anteriorly) (Ref. 33410).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Pseudocheilinus evanidus
Catalog Number: USNM 50678
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): Sindo
Locality: Henshaws Pool Near Hilo, Hawaii, United States, Hawaiian Islands, Pacific
  • Type: Jordan, D. S. & Evermann, B. W. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 192.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is commonly associated to rubble with turf (Hubble 2003). It was observed at Kuroshima (Japan) along the outer reef edge in depths of about 10 to 40 m, and usually solitary, being occasionally seen in groups of two or three individuals (Shepard and Okamoto 1977). It is rare in less than 20 m (Myers 1991). The depth range recorded in Fiji was from 3 to 30 m (Brunnschweiler and Earle 2006).

Females are similar to males in color pattern, but are generally less intensely hued (Shepard and Okamoto 1977). This species is supposed to reproduce during summer (June to August) at Miyakejima (Shepard and Okamoto 1977). It is generally solitary and feeds on small benthic invertebrates (Lieske and Myers 1994). It is known to show red fluorescence, in which the red fluorescent pigment is associated with bony scales and fin rays (Michiels et al. 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 6 - 40m.
From 6 to 40 meters.

Habitat: reef-associated. Pseudocheilinus evanidus Jordan & Evermann, 1903: 192 (Hawaii, Hawaiian Ids). = Pseudocheilinus evanidus = Striated wrasse.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 6 - 61 m (Ref. 33410), usually ? - 20 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 143 specimens in 1 taxon.
Water temperature and chemistry ranges based on 70 samples.

Environmental ranges
  Depth range (m): 1 - 80
  Temperature range (°C): 20.839 - 29.214
  Nitrate (umol/L): 0.027 - 4.459
  Salinity (PPS): 32.613 - 36.452
  Oxygen (ml/l): 4.130 - 4.871
  Phosphate (umol/l): 0.070 - 0.369
  Silicate (umol/l): 0.506 - 5.551

Graphical representation

Depth range (m): 1 - 80

Temperature range (°C): 20.839 - 29.214

Nitrate (umol/L): 0.027 - 4.459

Salinity (PPS): 32.613 - 36.452

Oxygen (ml/l): 4.130 - 4.871

Phosphate (umol/l): 0.070 - 0.369

Silicate (umol/l): 0.506 - 5.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Found among patches of rubble or among branching coral of seaward reef slopes from 6 to at least 40 m. Generally solitary and feeds on small benthic invertebrates. Rare in less than 20 m (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocheilinus evanidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATTTAGTATTTGGTGCTTGGGCCGGAATAGTAGGCACAGCCCTTAGCCTTCTGATCCGGGCAGAACTTAGCCAACCGGGGGCTCTTTTGGGTGATGATCAAATTTATAATGTGATCGTTACCGCACATGCTTTTGTAATAATCTTTTTTATGGTCATGCCAATTATAATTGGCGGTTTCGGAAATTGATTAATCCCGCTAATGATCGGCGCCCCCGACATGGCATTCCCGCGAATAAATAATATAAGCTTTTGACTCCTCCCCCCCTCTTTCCTCCTTCTCCTGGCCTCTTCAGGCGTGGAAGCCGGGGCAGGGACGGGCTGAACTGTTTACCCCCCACTAGCAGGCAACCTCGCACATGCAGGAGCATCCGTAGATTTAACAATCTTCTCACTCCACCTTGCAGGGATTTCCTCAATTTTAGGTGCAATTAATTTTATTACAACTATCATTAATATGAAGCCCCCGGCTATTTCCCAATACCAGACACCATTGTTCGTCTGAGCCGTCTTAATTACAGCCGTGCTTCTTCTCCTCTCTCTCCCAGTCCTTGCAGCTGGAATCACGATGTTACTAACAGACCGAAATCTTAATACTACTTTCTTTGACCCCGCACGAGGGGGGGACCCAATTCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocheilinus evanidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Bertoncini, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This is a very widespread species and is common throughout most of its range. There are no known major threats. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
For the Solomon Islands Marine Assessment (Allen 2006) it was considered moderately common, especially on outer reefs at depths from 6-40m. It is also common at Miyakejima (Izu Islands), found along eroded lava flows and rocky reefs in depths greater than 15m (Shepard and Okamoto 1977). Shepard and Okamoto (1977) also reported that although the holotype was found in a “deep tidal-pool in lava rocks”, Snyder (1904), reported specimens taken by the steamer “Albatross” about the Hawaiian islands from depths ranging between 50 and 140m.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is exploited in the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (Wood 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pseudocheilinus evanidus

The striated wrasse, Pseudocheilinus evanidus, is a species of wrasse native to the Indian and Pacific Oceans. This species inhabits coral reefs at depths from 6 to 61 m (20 to 200 ft). It can grow to 9 cm (3.5 in) in total length. It can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Bertoncini, A. 2010. Pseudocheilinus evanidus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 15 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Pseudocheilinus evanidus" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!