Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs over rubble or low patch reefs in areas of current (Ref. 9823); also on reef edges and around bommies with rubble zones (Ref. 48636); often in moderately large groups and mixed sex during feeding on zooplankton well above the substrate. Males often display to each other (Ref. 48636). Reported to be associated with the mushroom Heliofungia actiniformis (Ref. 91291). Feeds on zooplankton in the water column (Ref. 9823).
  • Randall, J.E. 1992 A review of the labrid fishes of the genus Cirrhilabrus from Japan, Taiwan and the Mariana Islands, with descriptions of two new species. Micronesica 25(1):99-121. (Ref. 5278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Found from east Africa to the Tuamotu Islands, north towards Japan and in the Great Barrier Reef of Australia.

The Exquisite Wrasse is predominantly the only species of Wrasse found over its geographic range.

(Randall, 2000; Allen, 2000)

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The most widespread species of the genus (Randall 2005). This species is found in the Indo-Pacific: from the east coast of Africa (type locality, Pinda Mozambique) to the Line Islands and the Tuamotu Archipelago, Ryukyu Islands to the far northern Great Barrier Reef (Randall 2005) and Palau and Kwajalein in Micronesia (Myers 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa south to Sodwana Bay, South Africa (Ref. 4392) and east to the Tuamoto Islands.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Color variation, due to geographic differences, is common between the Pacific and Indian Ocean forms. Males and females do not have the same coloring, although females attain the ability to change sex during their lifetime. When the female changes sex, her coloring and markings change into that of the male. The females are usually olive or reddish-brown in color with dark and light stripes that run along the sides of the body. A blue stripe is present on the posterior side of the female's body and dark spots are located on the underside of the fins. The males are more colorful and have bright red areas on the dorsal and pectoral fins. The younger forms do not differ greatly from the adults, but are distinguishable from the adults because they have a white spot on their nose.

(Randall, 2000; Allen, 2000)

Range mass: 0 to 0 kg.

Average mass: 2 kg.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 11; Dorsal soft rays (total): 8 - 9; Analspines: 3; Analsoft rays: 9
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs over rubble or low patch reefs in areas of current (Ref. 9823). Usually seen at depths less than 10 m (Ref. 5278). Feeds on zooplankton in the water column (Ref. 9823).
  • Froese, R. & D. Pauly (Editors). (2014). FishBase. World Wide Web electronic publication.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Large oval black spot on caudal peduncle just above lateral line (Ref. 4392). A closely related undescribed species occurs in west and central Pacific; differs in color, greatest between nuptial males (Ref. 48636).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The Exqusite Wrasse is normally found on reef slopes and lagoon habitats that are around ten meters below sea level. They prefer areas that are prone to strong currents.

(Randall, 2000; Allen, 2000)

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is usually found on exposed reefs from 2-10 m but has been seen at 32 m (Randall 2005).

Caudal fin rounded in juveniles and females, double emarginated in males. Adult males olivaceous dorsally shading to white, pale blue or pink ventrally. With an oval black spot generally as large as or larger than eye posteriorly on caudal peduncle with its lower edge on the lateral line, a blue line sometimes broken extending from below peduncular spot to beneath pectoral fin. An oblique blue line from corner of mouth above eye to nape and continuing along base of dorsal fin, another from behind eye, breaking up above pectoral fin, and a third from the corner of mouth to upper edge of pectoral fin base, base of pectoral fin with a blue-edged black bar, the margin of fin red, median fins with a variable amount of red. Juveniles and small females red with an oval blue-edged black spot posteriorly on caudal peduncle, and a medial white spot at front of snout.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 6 - 40 m (Ref. 48636), usually ? - 10 m (Ref. 5278)
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 2. Fusiliers - Dragonets, Caesionidae - Callionymidae. Zoonetics, Australia. 304-622 p. (Ref. 48636)
  • Randall, J.E. 1992 A review of the labrid fishes of the genus Cirrhilabrus from Japan, Taiwan and the Mariana Islands, with descriptions of two new species. Micronesica 25(1):99-121. (Ref. 5278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 2 - 40
  Temperature range (°C): 26.555 - 28.749
  Nitrate (umol/L): 0.057 - 1.118
  Salinity (PPS): 32.279 - 35.346
  Oxygen (ml/l): 4.448 - 4.712
  Phosphate (umol/l): 0.088 - 0.327
  Silicate (umol/l): 0.803 - 4.452

Graphical representation

Depth range (m): 2 - 40

Temperature range (°C): 26.555 - 28.749

Nitrate (umol/L): 0.057 - 1.118

Salinity (PPS): 32.279 - 35.346

Oxygen (ml/l): 4.448 - 4.712

Phosphate (umol/l): 0.088 - 0.327

Silicate (umol/l): 0.803 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 35m.
From 6 to 35 meters.

Habitat: reef-associated. Occurs over rubble or low patch reefs in areas of current (Ref. 9823). Feeds on zooplankton in the water column (Ref. 9823).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cirrhilabrus exquisitus is a carnivorous fish. It has a unique, sharp, tooth-like appendage enclosed in its mouth that is used to eat its larger prey which is primarily mollusks. In order to get through the hard shell, the Wrasse uses its sharp tooth to break the shell open. Its food also includes zooplankton, rotifers and copepods. Since these organisms are much smaller, the Exquisite Wrasse must filter these foods from the water.

(Shaws, 1999; Wells, 1999; Stevenson, 1999; Taggart, 1992)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs over rubble or low patch reefs in areas of current (Ref. 9823). Feeds on zooplankton in the water column (Ref. 9823).
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Exquisite Wrasse mates year round. The male courts females by following her and showing the brilliant colors located on the sides of his body. He then releases sperm into the water where the female filters it through her gills and becomes impregnated. Like most other marine life, the female does not watch over the eggs. The eggs hatch and the Wrasse enters what is sometimes called the larval stage. The newborn fish are colorless with a spot on the end of their nose. For food, they often clean the bacteria off other fishes gills until they are big enough to find food in other places.

(Shaws, 1999; Wells, 1999; Stevenson, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhilabrus exquisitus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTGGTATTTGGTGCTTGAGCTGGGATAGTTGGTACAGCCTTAAGCCTTCTTATTCGAGCAGAACTTAGTCAGCCTGGTGCACTCCTAGGTGATGATCAGATTTATAACGTAATCGTCACTGCGCACGCCTTCGTTATGATTTTCTTTATGGTCATGCCTATTATAATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGATATGGCATTCCCTCGAATAAATAATATGAGCTTCTGACTTCTCCCCCCCTCCTTCCTACTACTTCTTGCCTCATCTGGCGTAGAGGCTGGGGCAGGAACAGGATGAACTGTATACCCACCCTTGGCAGGGAATCTTGCGCATGCTGGTGCTTCCGTAGACCTGACTATCTTTTCCCTTCACCTTGCAGGAATTTCCTCTATTCTAGGTGCAATTAATTTTATTACAACCATTATCAACATGAAGCCCCCCGCTATTTCTCAGTACCAAACACCTCTATTTGTTTGAGCTGTGTTAATTACGGCAGTTCTCCTCCTGCTCTCTCTCCCAGTTTTAGCCGCTGGAATCACAATGCTTTTAACTGACCGAAATCTAAATACTACTTTCTTTGACCCTGCGGGAGGCGGGGATCCTATTCTTTACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhilabrus exquisitus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Exquisite Wrasse is already a rare fish to see, and now its habitat is being destroyed. The pollution accumulated by toxic wastes deposited into the oceans has created a habitat that is not well suited for the Wrasse. Since the Wrasse lives close to shore, it is subjected to denser deposits of toxic wastes.

(Shaws, 1999; Stevenson, 1999; Wells, 1999)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Yeeting, B. & Rocha, L.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and common, and is targeted for the aquarium trade in many parts of its range. However, taxonomic revision is needed as this species likely represents a species complex. It is listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. In the southwest Pacific, this species is considered to be common, but is less common in Micronesia.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species, although it is exploited in the aquarium trade. In the southwestern Pacific it is targeted but not always commonly traded as the collection is often driven by demand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures in place. However, species is found in several marine protected areas in parts of its range (i.e. Sulu-Sulawesi Marine Ecoregion (SSME), shelters Bunaken National Park, Gorontalo MPA, Berau MPA, Sangire Talaud and Phoenix Island Protected Area (PIPA)).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Cirrhilabrus exquisitus has an extremely unpleasant taste. Therefore it is not naturally hunted for food by humans.

(Allen, 2000; Randall, 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Exquisite Wrasse is an extremely interesting fish for scientists to study because of its ability to change sex mid-life.

(Allen, 2000; Randall, 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Exquisite wrasse

The exquisite wrasse, Cirrhilabrus exquisitus, is a species of wrasse native to the Indian Ocean from the African coast to the Tuamotus in the Pacific Ocean. It inhabits reefs at depths from 6 to 40 m (20 to 131 ft), though rarely deeper than 10 m (33 ft). This species can reach a standard length of 12 cm (4.7 in). It can be found in the aquarium trade.[2]

Common Name[edit]

Exquisite wrasse

Habitat[edit]

Salt water

Dispersion[edit]

Thai Sea Boundary

Utilization[edit]

Aquarium: Trade

References[edit]

  1. ^ Yeeting, B. & Rocha, L. 2010. Cirrhilabrus exquisitus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 03 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cirrhilabrus exquisitus" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!