Articles on this page are available in 1 other language: Arabic (26) (learn more)

Overview

Comprehensive Description

Biology

Anadromous species. Occurs solitarily or in small groups; inhabits shallow waters of continental shelves. At the sea, it occurs in coastal and estuarine areas on soft bottom (Ref. 59043) down to a depth of 50 m (Ref. 89115). Adults are highly migratory while at sea (Ref. 57533) and make long migrations along the coast (Ref. 59043). Forages mainly in brackish waters (Ref. 59043). Ascends large rivers to spawn (Ref. 59043). Juveniles may remain in fresh or brackish water until 2-5 years of age or 76-91.5 cm long (Ref. 4639, 59043). Today most individuals do not exceed 250 cm length. Tagging studies have shown that this species may move distances up to 1,450 km (Ref. 89119). Used smoked and fresh (Ref. 37032). Near threatened globally, but extirpated in Europe due to massive overfishing, damming, river regulation and pollution (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Gulf sturgeon, also known as the Gulf of Mexico sturgeon, are "anadromous" fish, inhabiting coastal rivers from Louisiana to Florida during the warmer months, and the Gulf of Mexico and its estuaries and bays in the cooler months. Sturgeon are primitive fish characterized by bony plates, or "scutes," and a hard, extended snout; they have a heterocercal caudal fin (their tail is distinctly asymmetrical with the upper lobe longer than the lower). Adults range from 4-8 feet (1-2.5 m) in length, females attain larger sizes than males. They can live for about 60 years; usually 20-25 years."

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm)

The Atlantic sturgeon is a long-lived, estuarine dependent, anadromous fish. Atlantic sturgeon can grow to approximately 14 feet (4.3 m) long and can weigh up to 800 lbs (370 kg). They are bluish-black or olive brown dorsally (on their back) with paler sides and a white belly. They have five major rows of dermal "scutes".

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hammock, Jen

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Subspecies oxyrinchus: Atlantic coast and major estuarine drainages from Labrador to northeastern Florida (at least formerly). Anadromous; spends most of adult life in salt or brackish water in the Atlantic Ocean from Hamilton River, Labrador, and George River, Ungava Bay, Labrador, south to St. Johns River, Florida, and ranging south in winter to Port Canaveral and Hutchinson Island, Florida. Spawning areas and juvenile fish are found in large coastal rivers and estuaries. Fresh and brackish water records are from the St. Lawrence River, Canada; Gulf of Maine; Hudson River, New York; the Delaware River, Pennsylvania; Susquehanna River and Chesapeake Bay, Maryland; Delaware Bay, Potomac, Rappahannock, York, and James River estuaries, Virginia; Roanoke River, North Carolina; Edisto, Pee Dee, Savannah, Ashepoo, Cooper, Congaree, Santee, Sanpit, Winyah and Waccamaw Rivers, South Carolina; and St. Mary's River, Georgia (Gilbert 1989, Collins and Smith 1997). May currently occur in Florida only as a winter resident (Hipes 1996). Little is known of the spawning grounds in Canadian waters (Marine and Coastal Species Information System 1996).

Subspecies desotoi: Gulf Coast and Gulf of Mexico from Suwannee River (and formerly Tampa Bay), Florida, to Lake Pontchartrain, Louisiana. There are old records from Bermuda and a doubtful record from French Guiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

A. oxyrinchus occurs in the Atlantic coastal waters of Canada and the United States with spawning rivers in both countries.

A. o. oxyrinchus historically ranged along the Canadian and U.S. Atlantic Coast from Labrador to Florida. Though Atlantic sturgeon populations are currently depressed from historic levels, breeding populations still exist in at least 14 Atlantic Coast rivers in the U. S. (Maine to Georgia) and several more in Canada (St. Lawrence, St. John).

A. o. desotoi occurs in most major river systems from the Mississippi River to the Suwannee River in Florida and in marine waters of the Central and Eastern Gulf of Mexico south to Florida Bay. Though the subspecies was previously listed as also occurring in Mexico, a review of the literature fails to support that contention. A single "sturgeon" was reported seen (but not captured) in the Rio Grande River which separates Texas and Mexico. The Gulf sturgeon’s current area of occupancy is spread over 2,500+ river km and 1,500+ km of coastline. However, construction of dams, sills and other water control structures throughout the 20th century severely restricted inland migrations of Gulf sturgeon in many waterways from St. Andrew Bay to the Bogue Chitto River.

For more information see NatureServe’s Explorer database.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern U.S.A. [this subspecies].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Hamilton River, Labrador, Newfoundland, Canada to northeastern Florida, USA. Occurs occasionally in Bermuda and French Guiana (Ref. 7251). Northern Gulf of Mexico (Ref. 26938). In Europe: Baltic Sea. Landlocked populations in Lakes Ladoga and Onega (Russia), both now extirpated. Occasionally recorded from Great Britain and North Sea in Elbe drainage (Ref. 59043). Recent research revealed that this species existed in the Baltic Sea, but is now extirpated (Ref. 83384, 83385). Near threatened globally, but extirpated in Europe (Ref. 59043). International trade restricted (CITES II, since 28.6.79).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gulf sturgeon are found in river systems from Louisiana to Florida, in nearshore bays and estuaries and in the Gulf of Mexico.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm)

Historically, Atlantic sturgeon were present in approximately 38 rivers in the United States from St. Croix, ME to the Saint Johns River, FL, of which 35 rivers have been confirmed to have had a historical spawning population. Atlantic sturgeon are currently present in approximately 32 of these rivers, and spawning occurs in at least 20 of them.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltic Sea basin and North America. North Atlantic to southeastern South America [subspecies *oxyrinchus*].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 30 - 46; Analspines: 0; Analsoft rays: 22 - 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 200 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

403 cm TL (male/unsexed; (Ref. 26938)); 430 cm TL (female); max. published weight: 368 kg; max. reported age: 60 years (Ref. 39404)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the shortnose sturgeon in having a longer, more sharply V-shaped snout, a larger number of scutes between the anal and caudal fins (4 vs. 1), preanal scutes in two rows rather than in one row, and a large number of scutes behind the dorsal fin (6-9 vs. 2). Differs from the white sturgeon in having scutes between the anal and caudal fins and between the dorsal and caudal fins (obvious scutes are absent in these locations in white sturgeon). Differs from green sturgeon in being blue-black above rather than green, and in having two rows of preanal scutes (vs. 1) and 4 (vs. 1) large scutes between the anal and caudal fins. See Page and Burr (1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Elongate fish, pentagonal in cross section and shark-like fins (Ref. 26938). Double row of pre anal shields. Presence of a soft fontanelle. Bony shields are oval. Carina on dorsal shields do not have a conspicuous hook. Head and back bluish-black and lower surface whitish (Ref. 37032). Snout long, sharply V-shaped. 2 pairs of short, slender barbels in transverse line midway between end of snout and anterior edge of mouth (Ref. 4639). Viscera pale (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Lookalikes

Atlantic sturgeon are similar in appearance to shortnose sturgeon (Acipenser brevirostrum), but can be distinguished by their larger size, smaller mouth, different snout shape, and scutes.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Primarily marine, but close to shore, when not breeding; migrates to rivers for spawning, moves downstream afterward (may stay upstream in winter in some northern areas).

Telemetered adults in Choctawhatchee Bay area, Florida, usually were in nearshore waters 2-4 m deep in winter and spring; individuals usually remained within small areas (which typically had sandy substrate containing benthic crustaceans and annelids) for several weeks but sometimes moved long distances (Fox et al. 2002). Most males stayed in the Bay whereas most females were in the Gulf of Mexico or could not be detected.

Juveniles spend winter and spring mainly in river mouths. In some rivers, juveniles may spend several years continuously in freshwater; in others, they may move downstream to brackish water when temperatures drop in the fall (Hoff 1980).

Spawns in fresh water (sometimes tidal) usually over bottom of hard clay, rubble, gravel, or shell. May spawn in brackish water. In the Pee Dee River, South Carolina, has been reported as spawning in relatively slow current in turbid water over substrates of sand and silt (see Gilbert 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Atlantic sturgeon is a large anadromous species. A. o. oxyrinchus is recorded to live for up to 60 years and reach a size of 4.3 m and 368 kg (Vladykov and Greely 1963), though most mature fish are considerably smaller. Spawning occurs in fresh or slightly brackish water when water temperatures reached 13–18˚C. Migrations into coastal tidal rivers begin as early as February in the southern portion of the range and continue through June and July in northernmost waters. In the mid-Atlantic area, Atlantic sturgeon males mature at 6–10 years and females at 10–20 years (ASMFC 1990). Maturation occurs earlier in southern waters and later in Canada. Spawning periodicity ranges from 2–6 years. Based on tagging studies ocean migrations of up to 1,450 km have been recorded (Dovel and Berggren 1983).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range ? - 46 m (Ref. 4639)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Gulf sturgeon are anadromous: adults spawn in freshwater and migrate into marine waters in the fall to forage and overwinter. Juvenile Gulf sturgeon stay in the river for about the first 2-3 years. Gulf sturgeon return to their natal stream to spawn. Riverine habitats where the healthiest populations of Gulf sturgeon are found include long, spring-fed, free-flowing rivers, typically with steep banks, a hard bottom, and an average water temperature of 60-72° F. Gulf sturgeon initiate movement up to the rivers between February and April and migrate back out to the Gulf of Mexico between September and November."

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm)

Atlantic sturgeon are "anadromous"; adults spawn in freshwater in the spring and early summer and migrate into "estuarine" and marine waters where they spend most of their lives. In some southern rivers a fall spawning migration may also occur. They spawn in moderately flowing water (46-76 cm/s) in deep parts of large rivers. Sturgeon eggs are highly adhesive and are deposited on bottom substrate, usually on hard surfaces (e.g., cobble). It is likely that cold, clean water is important for proper larval development. Once larvae begin migrating downstream they use benthic structure (especially gravel matrices) as refuges. Juveniles usually reside in estuarine waters for months to years. Subadults and adults live in coastal waters and estuaries when not spawning, generally in shallow (10-50 m depth) nearshore areas dominated by gravel and sand substrates. Long distance migrations away from spawning rivers are common.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hammock, Jen

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 59 specimens in 2 taxa.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 6.5 - 90.25
  Temperature range (°C): 7.967 - 17.205
  Nitrate (umol/L): 1.034 - 7.983
  Salinity (PPS): 32.397 - 35.134
  Oxygen (ml/l): 4.958 - 6.835
  Phosphate (umol/l): 0.314 - 0.690
  Silicate (umol/l): 1.861 - 4.888

Graphical representation

Depth range (m): 6.5 - 90.25

Temperature range (°C): 7.967 - 17.205

Nitrate (umol/L): 1.034 - 7.983

Salinity (PPS): 32.397 - 35.134

Oxygen (ml/l): 4.958 - 6.835

Phosphate (umol/l): 0.314 - 0.690

Silicate (umol/l): 1.861 - 4.888
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Adults migrate between fresh water spawning areas and salt water nonspawning areas. Makes extensive coastal migrations; may move up to 1500 km along coast from spawning rivers. Some individualscaptured in the Chesapeake Bay have come from as far north as the Hudson River and as far south as South Carolina (see Burkhead and Jenkins 1991). Wild and hatchery-reared juveniles tagged in the Hudson River have been captured in Chesapeake Bay and Delaware Bay (see Welsh et al. 2002). See Sturgeon Notes #4, (1996, Cornell University) for information on movements in the Hudson River.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on benthic invertebrates and small fishes as available (e.g., worms, crustaceans, aquatic insects, snails, sand lances).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on bottom plants, insect larvae, small crustaceans and molluscs when in fresh water, while molluscs, annelid worms, crustaceans and small fishes such as sand lance are consumed in the sea (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Gulf sturgeon are bottom feeders, and eat primarily macroinvertebrates, including brachiopods, mollusks, worms, and crustaceans. All foraging occurs in brackish or marine waters of the Gulf of Mexico and its estuaries; sturgeon do not forage in riverine habitat."

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm)

Atlantic sturgeon are benthic feeders and typically forage on "benthic" invertebrates (e.g. crustaceans, worms, mollusks) (Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hammock, Jen

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Subspecies OXYRINCHUS of Atlantic coast: historically present in approximately 34 rivers in the United States from the Penobscot River, Maine to the St. Johns River, Florida. It is not known how many of these rivers supported spawning. The current range has contracted slightly, from the Kennebec River, Maine (absence from the Penobscot River has not been conclusively determined) to the Satilla River, Georgia. This subspecies is currently present in 32 rivers, and spawning occurs in at least 14 of these rivers (possibly up to 19) (Atlantic Sturgeon Status Review Team 1998, NMFS 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Prior to 1890, there were an estimated 180,000 adult females in the Delaware Bay population (the largest east coast population), and approximately 20,000 in Chesapeake Bay, 29,000 in the southern Atlantic states (North Carolina, South Carolina, Georgia, Florida), and 6,000 in the Hudson River (Secor 2002).

Lake (1992) reported that the Atlantic and Gulf Coast spawning population (including the Hudson River) is 10,000 to 100,000 adults. Dovel and Breggren (1983) estimated that the juvenile population in the Hudson River alone matches these numbers.

Recently, 275 adults were collected off the coast of New Jersey (Johnson et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Following spawning, male Atlantic Sturgeon may remain in the river or lower estuary until the fall; females typically exit the rivers within four to six weeks. Juveniles move downstream and inhabit brackish waters for a few months and when they reach a size of about 30 to 36 inches (76-92 cm) they move into nearshore coastal waters. Tagging data indicate that these immature Atlantic sturgeon travel widely once they emigrate from their natal (birth) rivers.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Matures at increasing ages with increasing latitude (Ref. 88171). Both sexes do not spawn yearly and spawning intervals may vary according to area. In the St. Lawrence River, males spawn every 1-5 years, females every 3-5 years (Ref. 89103). Adults from the sea begin to ascend the lower reaches of large rivers in spring with the majority ascending immediately prior to spawning. Spawning occurs between March and August (Ref. 59043), when water temperature is 13.3-17.8 °C (Ref. 89118). Spawning occurs over bedrock, boulders or gravel bottoms, in depths exceeding 10 m at current velocities of 0.5-0.8 m/s (Ref. 59043, 89103). Exact time of spawning depends on temperature (Ref. 26938). Per female 0.4-8 million eggs may be spawned (Ref. 45706, 84845, 89137). Eggs demersal, sticking to stones, measuring 2.55 mm in diameter and hatching in 1 week at 17.8 °C (Ref. 4639, 9980). Adults return to the sea after spawning (Ref. 59043). Sturgeons in general have a high capacity for hybridization and most species are able to cross-breed (Ref. 89103, 89117).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Atlantic sturgeon have been aged to 60 years. There is generally faster growth and earlier age at maturation in more southern populations. For example, Atlantic sturgeon mature in South Carolina rivers at 5 to 19 years of age, in the Hudson River at 11 to 21 years, and in the Saint Lawrence River at 22 to 34 years.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 60 years (wild) Observations: Maximum longevity in these animals has been estimated at 42-60 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns as early as February-March in the south, April-May in Chesapeake Bay tributaries, May-July in north, at water temperatures of 13-21 C. Eggs hatch in about a week. Females first breed at about 11 years (mean) in South Carolina, 18-19 years in the Hudson River, about 27-28 years in the St. Lawrence River; generally matures at a younger age in the south than in the north (as early as 7 years or as late as 34 years). Successive spawnings may be separated by intervals of a few to several years. May live several decades. See Gilbert (1989) for much further information on reproduction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Gulf sturgeon migrate into rivers to spawn in the spring; spawning occurs in areas of clean substrate comprised of rock and rubble. Their eggs are sticky, negatively buoyant and adhere in clumps to snags, outcroppings, or other clean surfaces."

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm)

Spawning adult Atlantic Sturgeon migrate upriver in spring, beginning in February-March in the south, April-May in the mid-Atlantic, and May-June in Canadian waters. In some areas, a small spawning migration may also occur in the fall. Spawning occurs in flowing water between the salt front and fall line of large rivers. Atlantic sturgeon spawning intervals range from 1 to 5 years for males and 2 to 5 years for females. "Fecundity" of female Atlantic sturgeon is correlated with age and body size and ranges from 400,000 to 8 million eggs. The average age at which 50% of maximum lifetime egg production is achieved is estimated to be 29 years, which is approximately 3 to 10 times older than for other bony fish species.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hammock, Jen

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser oxyrinchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCCTGCTTGGCGACGACCAGATTTACAATGTTATCGTCACCGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATGATCGGCGGCTTCGGAAACTGACTGGTCCCCCTAATAATTGGAGCCCCAGATATAGCATTTCCTCGCATGAACAATATGAGCTTCTGGCTCCTACCCCCATCATTTCTGCTCCTTTTGGCCTCCTCTGGCGTAGAGGCCGGGGCCGGCACAGGGTGAACTGTCTACCCCCCACTGGCGGGGAACTTAGCCCATGCGGGAGCCTCTGTGGACCTAACCATTTTTTCTCTTCACCTGGCCGGGGTATCATCCATTTTAGGGGCTATTAACTTTATTACCACAATCATTAACATGAAACCCCCCGCAGTATCCCAGTATCAGACGCCCCTATTCGTGTGATCTGTGTTAATCACGGCCGTCCTTCTCCTACTATCACTGCCAGTGCTAGCTGCAGGGATCACAATACTCCTAACAGACCGAAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGGGGAGACCCCATTCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser oxyrinchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 9 specimens with morphological vouchers housed at Florida Museum of Natural History and Raffles Museum, Singapore
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widely distributed along the Atlantic and Gulf coasts from southeastern Canada to Louisiana; populations are much depleted throughout the range due to overfishing, habitat degradation, and blockage of spawning areas by dams; declines are continuing in some areas.

Intrinsic Vulnerability: Highly vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
St. Pierre, R. & Parauka, F.M. (U.S. Fish & Wildlife Service)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Contributor/s

Justification
A. oxyrinchus occurs in the Atlantic coastal waters of Canada and the United States with spawning rivers in both countries. A. o. oxyrinchus historically ranged along the Canadian and U.S. Atlantic Coast from Labrador to Florida. Though Atlantic sturgeon populations are currently depressed from historic levels, breeding populations still exist in at least 14 Atlantic Coast rivers in the U. S. (Maine to Georgia) and several more in Canada (St. Lawrence, St. John). A. o. desotoi occurs in most major river systems from the Mississippi River to the Suwannee River in Florida and in marine waters of the Central and Eastern Gulf of Mexico south to Florida Bay.

As flesh and roe (caviar) gained popularity in North American, the species was heavily exploited, particularly during several decades of the late nineteenth century. Severe over-fishing of mature sturgeon in the U.S. led to a crash of the A. o. oxyrinchus stocks and harvest was reduced by over 90% by the early 1900s and 99% by the 1920s. All U.S. Atlantic sturgeon fisheries have been closed since 1997, although Canada maintains active commercial fisheries in the St. Lawrence River and in the Saint John River. The current number of mature individuals most likely numbers considerably more than 10,000. Area of occupancy for this subspecies is very large (>1,500 river km spread over 3,000 km of coastline). Substantial subpopulation mixing may occur, particularly as sub-adults, and re-colonization of seriously depleted stocks may occur from adjacent healthy populations. Throughout the 20th century, sturgeon breeding habitats have been adversely impacted by dams, siltation, channel maintenance (dredging) and water pollution. Although habitat and water quality concerns still occur in several locations, the vast majority of formerly occupied habitats remain available to this species. The subspecies is assessed as Near Threatened based on past population declines and because of uncertainties about overall stock health and the lengthy time required for population recovery.

Records for A. o. desotoi fisheries during the period 1887–1985 indicated that peak Florida harvest occurred in 1900–1902 (124 mt/year) followed by precipitous decline into the 1920s. From 1923–1971 harvest was fairly stable at about 7 mt per year; declined to 2.3 mt through the 1970s; and fell further to only 0.3 mt until fisheries were closed in 1986 (Barkuloo 1988). A. o. desotoi continues to be threatened by habitat disturbances such as dam construction, dredging, dredge spoil disposal, groundwater extraction, irrigation and other surface water withdrawals, and flow alterations. Contaminants, primarily from industrial sources, also contribute adversely to individual fish health and population declines. With a relatively small and widely scattered population, continued habitat disturbances and contaminant threats, A. o. desotoi is assessed as Vulnerable.

Overall, the Atlantic sturgeon A. oxyrinchus is considered Near Threatened based on the population declines suffered in the past and uncertainties about overall health of the population and the lengthy time required for recovery.

History
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 30 to >90%

Comments: Overall, the species appears to have declined in recent years, although some populations still support limited fisheries (St. John River, New Brunswick). Populations in the Hudson and Delaware rivers apparently declined substantially during the latter years of the commercial harvest that ran through 1996 (Sturgeon Notes, Cornell University, November 1993; Atlantic Sturgeon Status Review Team 1998; NMFS 1998). Wild juveniles still exist in the Chesapeake Bay, though recent spawning there was undocumented as of 2002 (Welsh et al. 2002).

In some southern areas where the directed fishery has been closed for some time, limited
data from bycatch and fishery independent surveys suggest that those stocks are
rebuilding (Atlantic Sturgeon Status Review Team 1998). For example, limited sampling in the Cape Fear River, North Carolina, during 1997 suggested a substantial increase in abundance of juvenile Atlantic sturgeon in comparison to sampling during 1990-1992 (the fishery was closed in 1991). During 1995-1997, approximately 500 age < 1 Atlantic sturgeon were tagged in a single 0.5-mile section of the Edisto River, South Carolina. This suggests successful recruitment, which is indicative of a healthy population, despite heavy fishing pressure prior to the closure of the fishery in 1985 (Atlantic Sturgeon Status Review Team 1998).

See Waldman and Wirgin (1998) and Atlantic Sturgeon Status Review Team (1998) for a river by river description of status.

Global Long Term Trend: Decline of 50 to >90%

Comments: The overall population declined drastically over historical periods. Serious population declines occurred in the late 1800s and early 1900s and less drastic declines continued into the 1900s; in the Delaware Bay area, the center for sturgeon fishing, population sizes of all sturgeon species declined 95% between 1891 and 1901 (Gilbert 1989). The species is apparently extirpated in some areas (e.g., Maryland tributaries of Chesapeake Bay; St. Marys River, Florida-Georgia; possibly St. Johns River, Florida), but the overall range is not greatly reduced.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Atlantic sturgeon were an important item of commerce to early American and Canadian colonists and large quantities of meat, roe, oil and isinglass were exported to Europe late 17th and 18th centuries. As flesh and roe (caviar) gained popularity in North American, the species was heavily exploited, particularly during several decades of the late nineteenth century. The largest fishery was in the Delaware River and Bay which by 1890 supported over 1,000 fishermen and produced 2,300 metric tons of sturgeon product. Several dozen other rivers supported sturgeon fisheries and by the late 1890s, total Atlantic Coast U.S. landings reached 3,200 mt. Severe over-fishing of mature sturgeon in the U.S. led to a crash of the stocks and harvest was reduced by over 90% by the early 1900s and 99% by the 1920s. Throughout the 1970s to mid-1980s, prior to declaration of fishing moratoria, annual U.S. harvest of Atlantic sturgeon ranged from 50–100 mt with most fish being taken from the Hudson River (NY), coastal New Jersey and the Carolinas (ASMFC 1990).

In 1998, the U. S. Fish and Wildlife Service (USFWS) and National Marine Fisheries Service (NMFS) completed a comprehensive "Status Review of Atlantic Sturgeon" in response to a petition to list this species as threatened or endangered under the U. S. Endangered Species Act (ESA). The assessment found that, though Atlantic sturgeon populations are currently depressed from historic levels, breeding populations still exist in at least 14 Atlantic Coast rivers in the U. S. (Maine to Georgia) and several more in Canada (St. Lawrence, St. John). The number of mature individuals in this range-wide population was not estimated but most likely it numbers considerably more than 10,000. Area of occupancy is very large (> 1,500 river km spread over 3,000 km of coastline). Substantial subpopulation mixing may occur, particularly as sub-adults, and recolonization of seriously depleted stocks may occur from adjacent healthy populations.

A. o. desotoi population estimates have been completed for the Apalachicola, Suwannee, Yellow and Choctawhatchee rivers in Florida, Pascagoula River in Mississippi, and the Pearl and Bogue Chitto rivers in Louisiana and Mississippi. The Suwannee River supports the most viable subpopulation among coastal rivers of the Gulf of Mexico and was estimated at 7,650 individuals older than age two (Sulak and Clugston 1999). The subpopulation estimate for Gulf sturgeon older than age two in the Choctawhatchee River ranges from 1,700–3,000 fish, while subpopulation estimates in the Apalachicola, Pascagoula and Pearl rivers range from 50–350 fish (Lorio 2000). The number of mature individuals in this range wide population were not estimated but most likely number less than 10,000. Eggs and larvae of Gulf sturgeon have been collected in the Bouie, Escambia/Conecuh, Choctawatchee, Apalachicola and Suwanee rivers (Critical Habitat Ruling).

Stabile et al. (1996) analyzed A. o. desotoi subpopulations from eight drainages along the Gulf of Mexico for genetic diversity. They noted significant differences among Gulf sturgeon stocks and suggested they displayed region-specific affinities and may exhibit river-specific fidelity. These authors identified five regional or river-specific stocks: (1) Lake Ponchartrain and Pearl River; (2) Pascagoula River; (3) Escambia and Yellow rivers; (4) Choctawhatchee River; and (5) Apalachicola, Ochlockonee, and Suwannee rivers.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Total number of mature individuals throughout their range is unknown. However, among coastal rivers of the Gulf of Mexico, the Suwannee River supports the most viable subpopulation, which was estimated at 7,650 adults. The subpopulation estimate for mature Gulf sturgeon in the Choctawhatchee River ranges from 1,700-3,000 fish; estimates in the Apalachicola, Pascagoula and Pearl rivers range between 50-350 fish.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm and references cited)

Studies have consistently found Atlantic Sturgeon populations to be genetically diverse and indicate that there are between 7 and 10 populations that can be statistically differentiated. However, there is some disagreement among studies, and results do not include samples from all rivers inhabited by Atlantic sturgeon. There are only two Atlantic sturgeon populations for which size estimates are available - the Hudson River and the Altamaha River populations. In 1995, sampling crews on the Hudson River estimated that there were 9,500 juvenile Atlantic sturgeon in the estuary. Since 4,900 of these were stocked hatchery-raised fish, about 4,600 fish were thought to be of wild origin. The mean annual spawning stock size (spawning adults) was estimated at 870 (600 males and 270 females). The Altamaha River supports one of the healthiest Atlantic sturgeon populations in the Southeast, with over 2,000 subadults captured in research surveys in the past few years, 800 of which were 1 to 2 years of age. The population appears to be stable.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Stocks on the Atlantic slope have been severely reduced by overfishing (mainly late 1800s and early 1900s), pollution, sedimentation, and blockage of access to spawning areas by dams (Gilbert 1989, Burkhead and Jenkins 1991, Marine and Coastal Species Information System 1996).

Commercial harvest targeted adult females (source of caviar), which led to fisheries collapse (Secor 2002). In recent years, landings in Canadian waters have increased substantially whereas in the U.S. landings are more controlled or prohibited; fishery managers in Canada are in the process of establishing more stringent regulations (Smith and Clugston 1996). Current information indicates that accidental mortality of Atlantic sturgeon bycatch does not threaten or endanger populations along the Atlantic coast (Atlantic Sturgeon Status Review Team 1998). In the southeastern U.S., significant numbers are caught, killed, and/or injured in gill-net fishery for American shad and in trawl fishery for PENAEUS shrimp (Collins et al. 1996).

Habitat loss due to dam construction and water pollution are thought to be major factors impeding full recovery of populations (Smith 1985, cited by Johnson et al. 1997; Gilbert 1989). In Chesapeake Bay and elsewhere in the range, hypoxic events have increased and may degrade nursery habitat for Atlantic sturgeon (Secor and Gunderson 1997). Declines in water quality in coastal bays and in the Gulf of Mexico may hinder recovery by negatively impacting benthic invertebrate communities; sturgeons rely on these areas for nourishment during periods of gonadal growth (Fox et al. 2002). A late maturation age and use of estuaries, coastal bays, and upstream areas of rivers for spawning and juvenile development make stocks vulnerable to habitat alterations in many areas.

See NMFS (1998) and Atlantic Sturgeon Status Review Team (1998) for further details and evaluation of current threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Atlantic sturgeon were an important item of commerce to early American and Canadian colonists and large quantities of meat, roe, oil and isinglass were exported to Europe late 17th and 18th centuries. As flesh and roe (caviar) gained popularity in North American, the species was heavily exploited, particularly during several decades of the late nineteenth century.

Competition, predation, diseases and parasites were evaluated in the 1998 status review by USFWS-NMFS and determined not to be limiting factors for Atlantic sturgeon stocks. Throughout the 20th century, sturgeon breeding habitats have been adversely impacted by dams, siltation, channel maintenance (dredging) and water pollution. Although habitat and water quality concerns still occur in several locations, the vast majority of formerly occupied habitats remain available to this species. Continued application of existing U.S. laws (e.g., Clean Water Act, Fish and Wildlife Coordination Act, etc.) should result in improvements sturgeon breeding and nursery habitats. With management measures in place the current population trend for Atlantic sturgeon is increasing.

A. o. desotoi continues to be threatened by habitat disturbances such as dam construction, dredging, dredge spoil disposal, groundwater extraction, irrigation and other surface water withdrawals, and flow alterations. Contaminants, primarily from industrial sources, also contribute adversely to individual fish health and population declines. Tissue and egg samples of Gulf sturgeon have shown elevated levels of pesticides and heavy metals. Organochlorines such as DDT and its derivatives DDD and/or DDE and toxaphene appear in most samples, sometime in concentrations exceeding U.S. Federal Drug Administration action levels for human consumption. High concentrations of polycyclic aromatic hydrocarbons and aliphatic hydrocarbons (both from petroleum products) were detected in most Gulf sturgeon samples from numerous Florida rivers. Arsenic and mercury were detected in 92% and 87% of sturgeon samples and cadmium occurred in 42% of samples (Bateman and Brim 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gulf sturgeon number initially declined due to overfishing throughout most of the 20th century. Habitat loss was exacerbated by the construction of water control structures, such as dams and "sills", mostly after 1950. Other habitat disturbances such as dredging, groundwater extraction, irrigation, and flow alterations also threaten the Gulf sturgeon. Poor water quality and contaminants, primarily from industrial sources, also contribute to population declines.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/gulfsturgeon.htm)

Historical overharvest led to wide-spread declines in Atlantic sturgeon abundance. A large U.S. commercial fishery (100,000 - 250,000 lbs/yr) existed for Atlantic sturgeon from the 1950s through the mid-1990s; the origin of the fishery dates back to colonial times. Since a 1998 harvest moratorium there have been few surveys to assess status and abundance. "Bycatch" of sturgeon in fisheries targeting other species is a current threat in the ocean environment.

In their estuarine and freshwater habitats, Atlantic sturgeon face additional threats, including habitat degradation and loss from various human activities such as dredging, dams, water withdrawals, and other development. Some populations are being impacted habitat impediments including locks and dams (e.g., Cape Fear and Santee-Cooper Rivers ) and ship strikes (e.g., Delaware and James Rivers). Although there are no known diseases threatening Atlantic sturgeon populations, there is concern that non-indigenous sturgeon pathogens could be introduced through aquaculture operations.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Genetic differentiation among populations indicates that this species has low intrinsic rates of recolonization of rivers; combined with a low rate of population increase, this suggests that natural recolonization and population recovery may take decades or centuries (Waldman and Wirgin 1998).

Management Requirements: Hatchery-reared individuals have been released in the Hudson River (New York) and Nanticoke River, Chesapeake Bay (Welsh et al. 2002). Commerical fisheries in Chesapeake Bay caught 420 of 3,300 individuals released in the Nanticoke in the four years following the release (Welsh et al. 2002).

For recent information on Hudson River sturgeon, see Sturgeon Notes, a newsletter of Cornell University and the Hudson River Foundation.

Management Research Needs: Current research focus: life history and population status studies, stock delineation, and development of culture and stock enhancement techniques (Smith and Clugston 1996).

Biological Research Needs: Determine specific habitat needs. Determine population numbers in coastal bays, estuaries, and rivers. Determine extent of threats. Continue study of the feasibility of hatchery culture and stocking in restoring populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Harvest is banned in all U.S. jurisdictions inhabited by this fish, but incidental catch occurs in commercial fisheries and this does not provide habitat protection.

Needs: Maintain the U.S. moratorium on harvesting. Improve water quality in rivers, restrict habitat alteration, regulate commercial fishing; protect spawning sites.

Smith (1985, cited by Johnson et al. 1997) recommended a rangewide threatened or endangered designation and a moratorium on harvest. The management plan adopted by the Atlantic States Marine Fisheries Commission in 1990 called for size limits, a moratorium on harvest, or adoption of alternative measures that are conservationally equivalent (Taub 1990, cited by Johnson et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
All U.S. Atlantic sturgeon fisheries have been closed since 1997. Canada maintains active commercial fisheries in the St. Lawrence River (Quebec) for subadults of A. o. oxyrinchus, and in the Saint John River (New Brunswick) for larger fish. Also, a single fisherman is licensed on the Shubenacadie River in Nova Scotia. The St. Lawrence fishery was limited in 1997 to a quota of 6,015 fish - about 60 tons (Caron and Trembly 1997). Other regulations here include a maximum size limit of 1.5 m during a season extending from 1 May to 30 September.

Peak landings on the Saint John River were 44 metric tones (mt) in 1988 but have declined in recent years to 10–14 mt. Only nine licensed fishermen remained in the St. John fishery in 1997. They were authorized to fish no more than 2,800 m of gill net with minimum mesh size of 33 cm. Minimum allowable size of sturgeon on the St. John is 120 cm and the season is closed during 1–30 June to protect spawners. Canadian authorities have expressed to U.S. authorities that these harvest levels are sustainable and do not damage the stocks (USFWS and NMFS 1998). A private aquaculture activity also occurs in New Brunswick with eggs and progeny produced from wild-caught adult sturgeon. Except for a few hundred live juveniles, most international trade in A. o. oxyrinchus in the late 1990s has been meat (2–34 mt/year) from Canada to the U.S. (CITES data).

No commercial or sport fishing for Atlantic sturgeon is allowed in territorial waters of the U.S. Atlantic Coast. The management authority for this species is the Atlantic States Marine Fisheries Commission and their amendment to the 1990 Fishery Management Plan (ASMFC 1998) requires (1) no possession allowed in the 15 Atlantic states until at least 20 year-classes reach breeding age (30–40 years); (2) annual reporting of by-catch and by-catch mortality; (3) urges habitat monitoring and improvements as well as research and genetics analysis; and (4) places certain restrictions on sturgeon culture for market production and restocking. In addition to the ASMFC action, the Secretary of Commerce has closed all U.S. Atlantic coastal EEZ waters to harvest of Atlantic sturgeon.

The recent USFWS-NMFS joint status review for Atlantic sturgeon determined that listing this species as threatened or endangered under the U.S. ESA is not warranted at this time. Atlantic sturgeon are widespread and several subpopulations could be considered relatively abundant. However, because of uncertainties about overall stock health and the lengthy time required for population recovery, USFWS has designated Atlantic sturgeon as a "candidate species" for possible future ESA listing and NMFS lists it as a "species of concern".

In 1991, A. o. desotoi was listed as Threatened under the U.S. Endangered Species Act (ESA). Since then considerable work has been accomplished to better define life history and behavior and to determine habitats important to each life stage, population status, genetic assessment and fish culture. A recovery and management plan for Gulf sturgeon was completed in 1995 (USFWS and GSMFC 1995). This plan identifies state and federal actions necessary to rebuild populations to levels that would allow de-listing of the subspecies. In 2002, the U.S. Fish and Wildlife Service and National Marine Fisheries Service officially designated "critical habitat" for this species, including 2,783 river kilometers and 6,042 square km of estuarine and marine habitat.

With federal protection under the ESA and intensive permitting and consultation requirements for all water-related projects and discharges - especially in areas designated to be critical habitat - it is believed that A. o. desotoi population declines will be halted and reversed.

This species is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Atlantic sturgeon is managed under a Fishery Management Plan implemented by the Atlantic States Marine Fisheries Commission (ASMFC). In 1998, the ASFMC instituted a coast-wide moratorium on the harvest of Atlantic sturgeon, which is to remain in effect until there are at least 20 protected age classes in each spawning stock (anticipated to take up to 40 or more years). NMFS followed the ASMFC moratorium with a similar moratorium for Federal waters. Amendment 1 to ASMFC's Atlantic sturgeon Fishery Management Plan also includes measures for preservation of existing habitat, habitat restoration and improvement, monitoring of bycatch and stock recovery, and breeding/stocking protocols.

(Office of Protected Resources, http://www.nmfs.noaa.gov/pr/species/fish/atlanticsturgeon.htm)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Limited commercial fishery (much more important in late 1800s, before population decline, especially in Delaware Bay); no significant sport fishery (Gilbert 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acipenser oxyrinchus

Acipenser oxyrinchus is a species of sturgeon.

Information[edit]

Acipenser oxyrinchus is a species with two subspecies:

Their main diet includes crustaceans, worms, and mollusks. This species is also known to migrate up the river when it is spawning.[2] This species is also recorded to be near threatened of becoming an endangered species due to dam construction, dredging, dredge spoil disposal, groundwater extraction, irrigation and other surface water withdrawals, and flow alterations. The Acipenser oxyrinchus is native to the countries of Canada and the United States.[3] They can be found in sub-tropical climates and in a marine, freshwater environment.[4]

Characteristics[edit]

The Acipenser oxyrinchus can grow to the average length of 14 feet and the average weight of 800 pounds. The lifespan of this species can be around 60 years. The color of the Acipenser oxyrinchus is bluish-black or olive brown with lighter sides and a white belly.

Behavior[edit]

Sturgeon are an anadromous species that live solitarily or in small groups. They migrate upriver in the spring to spawn. Sturgeons tend to inhabit the shallow waters of coastal shelves, coastal and estuarine areas on soft bottom in the sea, and can live down to a depth of 50 meters. Adults are migratory while at sea and will make long migrations to coastal areas, while juveniles will stay in fresh or brackish water until they are between two to five years of age. However, many larvae and juveniles do start to migrate and disperse small distances from their spawning sites.[5]

Migration[edit]

Sturgeons will migrate upriver to spawn. Sturgeons from the Gulf of Mexico will naturally exhibit spawning migration in the spring. Peak numbers have been observed in March and April, which is when the fish will migrate into the Suwanee River in Florida.[6] Sturgeon will migrate downstream for twelve days, peaking within the first six days. Atlantic sturgeons only need to move a short distance to reach rearing areas. Early sturgeon migrants tend to be nocturnal while later migrants are diurnal.[7] During summer months, sturgeon will remain in localized bottom areas of the rivers. In the late fall, the sturgeon migrate out of spawning rivers and into the Gulf of Mexico.[6]

For all populations and subspecies of sturgeon, there are spawning migrations into freshwater in early spring and movement into salt water in the fall. Timing and the unusual migratory behavior of sturgeon is a result of temporal water temperature changes.[6] Studies have also shown that amongst sturgeon in Gulf of Mexico and Suwannee River in Florida, fish gained 20% of their body weight while in Gulf of Mexico and lost 12% of their body weight during their time in the river.[8]

Spawning[edit]

The maximum level of survival for eggs, embryos, and larvae is at 15 to 20°C. Studies have shown that high mortalities are seen at temperatures of 25°C or higher.[6] In order for spawning to occur, water temperature should be above 17°C. Spawning normally lasts between nine and twenty-three days, but can continue past this as long as the water temperature remains below 22C.[9]

Free sturgeon embryos (the first interval of sturgeon after hatching) hide under rocks and do not migrate. They are found in the freshwater spawning areas. Larvae and some juveniles start to migrate slowly for about five months downstream. This leads to a wide dispersal of the fish.[10] Typically, the entire freshwater reach of the river downstream from the actual spawning site is so filled with larva-juvenile individuals that it is considered to be a nursery habitat.[10]

Sturgeon populations will use the same spawning reefs from year to year. Habitat factors that can help determine spawning sites include the presence of gravel substrate, presence of eddy fields, slightly basic pH, and a range in calcium ion content. Eggs are usually deposited in a small area and scatter very little. It is not until larvae and juveniles start to migrate that the fish disperse widely.[9]

Body color[edit]

Some evidence has shown that developmental body color is related to migration style. Free embryos are light and are non-migratory, while migratory larvae and adults are dark. This is found to be consistent among many Acipenser species. The reason for this is unclear, but it may be adaptive to migration behavior and camouflage.[10]

Diet[edit]

The primary foods of sturgeon while in freshwater areas include soft-bodied annelids, arthropods, aquatic insects, and globular mollusks. Adults that have emigrated from estuaries and into the sea will usually feed on epibenthic and hyperbenthic amphipods, grass shrimp, isopods, and worms. Most adult sturgeon will also feed on detritus and biofilm.[11] Sturgeons are most generally known for feeding on crustaceans, worms, and molluscs.[12]

Larvae-juvenile feeding was at the bottom, benthic foraging. However, food in the benthic zone is scarce, so many adapt drift feeding, in which they have holding positions in the water column and wait for food.[10] Sturgeons may have dominance hierarchies with large fish being dominant when competing for limited foraging space.[7]

Habitat[edit]

Sturgeons are widely distributed along the Atlantic coast of the United States. Their wide distribution and tendency to disperse has led to numerous subspecies of sturgeon.[12]

In general, sturgeons usually inhabit primarily the temperate waters of the northern hemisphere. Gulf of Mexico sturgeons are probably adapted to warmer water temperatures. Due to sturgeons' predilection for cooler waters, when water temperatures rise too high, sturgeon will try to find cool spring waters which serve as thermal refuges until temperatures drop again.[6]

Susceptibility to anthropogenic disturbances[edit]

There are many wide-ranging subspecies along the Atlantic Coast of North America. Identification of distinct population segments (DPS) is problematic because of sturgeons' ability to disperse so widely. However, it is possible to do some characterization of genetic differentiation and estimate gene flow. This method has been used to determine possibility for listing under the U.S. Endangered Species Act.[13]

The sturgeon’s characteristics and life history make it susceptible to anthropogenic disturbances and make population restoration particularly difficult. They have late sexual maturity, only moderate fecundity, and spawn at low frequencies. Females spawn once every three to five years, and males every one to five years. This is due to their ability to live for an extremely long time (various sub-species can have a lifespan ranging from ten years to sixty years).[13]

The population of Atlantic sturgeons has decreased dramatically in the past century due to overharvesting. They are particularly susceptible to bycatch mortality due to the many fisheries that exist within their natal estuaries. Their habitat range, which usually includes coastal spawning sites and coastal migrations, makes sturgeon well within contact of coastal fisheries.[13]

Effects of hypoxia[edit]

Hypoxia combined with high water temperatures in the summer has been shown to be consistent with decreased survival rates of young of the year sturgeon in Chesapeake Bay.[14]

Hypoxia is defined as low ambient oxygen levels, which may be very harmful to organisms living in the hypoxic body of water. Often, lower regions of the water column will be more hypoxic than upper levels, closer to the surface. When surface access is denied, the situation is lethal to sturgeon. Increased incidences of summertime hypoxia have led, in part, to degradation of many sturgeon nursery habitats in the United States.[14]

References[edit]

  1. ^ St. Pierre, R. & Parauka, F.M. (U.S. Fish & Wildlife Service) (2006). Acipenser oxyrinchus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 February 2009.
  2. ^ "Atlantic Sturgeon (Acipenser oxyrinchus oxyrinchus)". NOAA Fisheries. Retrieved 24 February 2013. 
  3. ^ "Acipenser oxyrinchus". International Union for Conservation of Nature and Natural Resources. Retrieved 24 February 2013. 
  4. ^ "Acipenser oxyrinchus". Fish Base. Retrieved 24 February 2013. 
  5. ^ Froese, Rainer. "Acipenser oxyrinchus". Fish Base. Retrieved 24 October 2013. 
  6. ^ a b c d e Chapman, Frank A.; Stephen H. Carr (August 1995). "Implications of early life stages in the natural history of the Gulf of Mexico sturgeon, Acipenser oxyrinchus de sotoi". Environmental Biology of Fishes 43 (4): 407–413. doi:10.1007/bf00001178. Retrieved 24 October 2013. 
  7. ^ a b Kynard, Boyd; Martin Horgan (February 2002). "Ontogenetic Behavior and Migration of Atlantic Sturgeon, Acipenser oxyrinchus oxyrinchus, and Shortnose Sturgeon, A. brevirostrum, with Notes on Social Behavior". Environmental Biology of Fishes 63 (2): 137–150. Retrieved 25 October 2013. 
  8. ^ Carr, S.H.; F. Tatman; F. A. Chapman (December 1996). "Observations on the natural history of the Gulf of Mexico sturgeon (Acipenser oxyrinchus de sotoi Vladykov 1955) in the Suwannee River, southeastern United States". Ecology of Freshwater Fish 5 (4): 169–174. doi:10.1111/j.1600-0633.1996.tb00130.x. 
  9. ^ a b Sulak, K.J.; J.P. Clugston (September 1999). "Recent advances in life history of Gulf of Mexico sturgeon, Acipenser oxyrinchus desotoi, in the Suwannee river, Florida, USA: a synopsis". Journal of Applied Ichthyology 15 (4-5): 116–128. doi:10.1111/j.1439-0426.1999.tb00220.x. Retrieved 24 October 2013. 
  10. ^ a b c d Kynard, Boyd; Erika Parker (May 2004). "Ontogenetic Behavior and Migration of Gulf of Mexico Sturgeon, Acipenser oxyrinchus desotoi, with Notes on Body Color and Development". Environmental Biology of Fishes 70 (1): 43–55. doi:10.1023/b:ebfi.0000022855.96143.95. Retrieved 24 October 2013. 
  11. ^ Mason Jr., William T.; James P. Clugston (1993). "Foods of the Gulf Sturgeon in the Suwannee River, Florida". Transactions of the American Fisheries Society 122 (3): 378–385. doi:10.1577/1548-8659(1993)122<0378:fotgsi>2.3.co;2. Retrieved 24 October 2013. 
  12. ^ a b "Atlantic Sturgeon (Acipenser oxyrinchus oxyrinchus)". NOAA Fisheries Office of Protected Resources. Retrieved 24 October 2013. 
  13. ^ a b c Grunwald, Cheryl; Lorraine Maceda; John Waldman; Joseph Stabile; Isaac Wirgin (October 2008). "Conservation of Atlantic sturgeon Acipenser oxyrinchus oxyrinchus: delineation of stock structure and distinct population segments". Conservation Genetics 9 (5): 1111–1124. doi:10.1007/s10592-007-9420-1. Retrieved 24 October 2013. 
  14. ^ a b Secor, David H.; Troy E. Gunderson (1998). Effects of hypoxia and temperature on survival, growth, and respiration of juvenile Atlantic sturgeon, Acipenser oxyrinchus 96 (3). pp. 603–613. Retrieved 24 October 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Closely related to, but specifically distinct from, Palearctic A. sturio (see Lee et al. 1980).

Two subspecies are recognized: A. o. oxyrinchus along the Atlantic coast and A. o. desotoi along the Gulf Coast (Page and Burr 1991). See Ong et al. (1996) for genetic data supporting the subspecific designations. MtDNA data reveal strong stock structure along both the North American Atlantic and Gulf coasts at the regional and, in some instances, population levels (Waldman and Wirgin 1998).

The original (and hence correct) spelling of the specific name is "oxyrinchus," not "oxyrhynchus." The latter name, though long in use, must therefore be replaced by the former (see Gilbert 1992:33).

Gene sequencing data of Birstein and DeSalle (1998) indicate that there are least three main clades within Acipenser: A. sturio - A. oxyrinchus, A. schrenckii - A. transmontanus, and all Ponto-Caspian species plus A. dabrysnus and A. brevirostrum.

Krieger et al. (2000) examined phylogenetic relationships of North American sturgeons based on mtDNA sequences and found that (1) nucleotide sequences for all four examined genes for the three Scaphirhynchus species were identical; (2) the two Acipenser oxyrinchus subspecies were very similar in sequence; (3) A. transmontanus and A. medirostris were sister taxa, as were A. fulvescens and A. brevirostrum (in constrast to Birstein and DeSalle 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!