Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Comprehensive Description

Biology

Inhabits deep parts of large rivers, with moderate to swift current (Ref. 59043). Adults live essentially in freshwater although some fish frequently occur in estuaries. Males are sexually mature between 9-15 years; females between 16-20 years (Ref. 11941). Spawns in main river channel over stone-gravel or gravel-sand bottom and with strong current (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from all Siberian rivers draining to the Kara, Laptev and East Siberian seas: basins of the Ob, Taz, Yenisei, Pyasina, Khatanga, Anabar, Olenyek, Lena, Yana, Indigirka, Alazeya (rarely) and Kolyma rivers, Lake Baikal (the Yenisei River basin) and rivers flowing to the lake – the Selenga, Barguzin and Upper Angara. It is most abundant in the Ob, Yenisei and Lena rivers.

This species is also native to the the Irtysh River, in the northwest of Xin jiang province, China. However, wild populations were extirpated from here in the 1950s; the small population that remains here is from stocking (Chen 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Asia: Siberia, rivers Ob, Irtysh, Yenisei, Lena, Kolyma. Some non-migratory populations exist in the Irtysh River system. International trade restricted (CITES Appendix II, since 1.4.1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeastern Asia; introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 40476)); max. published weight: 210.0 kg (Ref. 59043); max. reported age: 60 years (Ref. 52333)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Extended snouts; four barbels in front of the mouth (Ref. 4639). The back is light grey to dark brown colored. The belly color varies from white to clear yellow. Five row s of scutes: 10-19D, 32-59L, 7-16V. Small star-like scutes between the main ones. Clearly slit inferior lip (Ref. 40476).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can be found in all types of freshwater benthic habitats in large rivers and lakes. It spawns in strong-current habitats in the main stream of large and deep rivers on stone or gravel bottom. Numerous spawning sites are located in lower and middle reaches of rivers. Spawning peaks at beginning of June, continuing until end of July.

Spawning periodicity is 3-5 years in females and 2-3 years in males. The generation length of the species ranges from 25-30 years (Chen 2007, Ruban 2005). In northeastern populations, females are twice the age of males (Ruban 2005). The average age at maturity for females is 11 (in Lena River) to 22 (in Lake Baikal), and 9-19 years for males.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; pH range: 7.0 - 7.5; dH range: 20; depth range 1 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Reported to reach a length of 153 TL (approximately 30,000 g) in the freshwater Shakujii Hatchery (Ref. 9978). Lives essentially in freshwater although some fish frequently occur in estuaries. Males are sexually mature between 9-15 years; females between 16-20 years (Ref. 11941).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Anadromous species. In a natural environment, males reach sexual maturity at 9-1 5 years of age and females at 16-20 years (in water recirculation systems, sexual maturity can first occur at 5 years). Spawning happens in the summer and generally every two years. Membranes on eggs become increasingly more sticky after fertilization and this allows them to stick to thesubstratum. This can become a problem in nurseries, but it is solved by washing the eggs in clay or diatomaceous earth suspensions. Caviar (not fecundated ovocites ) can be over 1 0% of the corporal weight of a mature female. Incubationlasts about 1 6 days (at 10-1 5°). Larvaedevelopment lasts about 20 days (at 18°). Egg size 3.0-3.6 mm, larval length at hatching 10-12 mm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser baerii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 39 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTTCACCAACCACAAAGACATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCCTGCTTGGCGATGATCAAATCTACAATGTTATCGTTACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGGGCCCCAGACATGGCATTTCCTCGCATGAACAATATGAGCTTCTGACTCCTACCCCCATCCTTCCTACTCCTTTTAGCCTCCTCTGGGGTAGAGGCCGGAGCCGGCACAGGGTGAACTGTTTACCCTCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCCCTTCACCTGGCTGGGGTTTCGTCCATTTTGGGGGCTATTAATTTTATTACCACCATTATTAACATGAAACCCCCCGCAGTATCCCAATATCAGACACCTCTATTTGTGTGATCTGTATTAATCACGGCCGTACTCCTCCTGCTATCACTGCCAGTGCTAGCTGCAGGGATCACAATACTCCTAACAGACCGAAATTTAAACACCACCTTCGTTGAACCAGCCGGAGGGGGAGACCCCATCCTCTACCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTATATATTCTAATTCTGCCGGGATTCGGCATGATCTCCCATATTGTGGCATACTATGCCGGCAAAAAGGAACCTTTTGGCTACATAGGAATAGTATGAGCTATGATGGCTATTGGGCTACTAGGCTTTATCGTATGAGCTCATCACATGTTTACAGTTGGAATGGACGTAGACACACGGGCCTACTTTACCTCCGCCACAATAATTATTGCCATCCCCACAGGTGTCAAAGTCTTTAGCTGATTGGCCACCCTTCATGGTGGTTCAATTAAATGAGATACCCCTCTACTTTGAGCCTTAGGCTTTATCTTCCTATTCACAGTGGGAGGCTTAACGGGAATTGTCTTAGCCAACTCGTCTCTAGATATTGTACTTCACGACACCTACTACGTTGTAGCACATTTCCACTATGTATTATCAATGGGAGCTGTGTTCGCCATTATAGGGGCCTTCGTACACTGATTCCCGCTTTTCACGGGTTATACACTACACGGCACCTGGTCCAAAATCCACTTTGCTGTAATATTTGTAGGTGTCAATTTAACATTCTTCCCCCAACACTTCCTAGGCCTCGCAGGAATGCCTCGCCGATACTCAGACTACCCAGACGCATACGCCCTATGAAACACCGTCTCCTCAATCGGCTCACTAATCTCATTAGTTGCTGTGATTATATTCCTATTTATTCTGTGAGAAGCATTCGCGGCTAAACGAGAAGTTATGTCAGTAGAACTAACAACCACAAATGTAGAGTGACTTCACGGCTGCCCACCCCCATATCACACCTATGAAGAGCCTGCCTTTGTGCAAGTGCAATCAACCAGCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser baerii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcd+4bcd

Version
3.1

Year Assessed
2010

Assessor/s
Ruban, G. & Bin Zhu

Reviewer/s
Pourkazemi, M. & Smith, K.

Contributor/s

Justification
The species has undergone a sharp decline in both stock and recruitment. The stock decline started in the 1930s, when demand was significantly high, and continues to decline. From the 1930s to 1990s annual sturgeon catches have declined in the Ob (which is estimated to contain 80% of the global population) by 99.5%; in the Yenisei by 97.5% and Lena by 94.5%. Therefore the total global population decline is estimated to be 50-80% over the past 60 years. The three generation period of this species is 75-90 years. This decline is likely to continue into the future. Since the beginning of 1990s, stock abundance declines have mainly been caused by overfishing and dam construction (for hydropower). Also illegal catches cause declines, affecting the abundance mainly of the spawning stock. In all populations especially in populations of the Ob and Kolyma rivers abnormalities were observed in the development and functioning of the reproductive system up to complete sterility of females, caused by water pollution from mining. Abnormalities were observed in 80-100% of females in these rivers. Natural reproduction of the Ob River population has significantly decreased mainly due to damming. Restoration of the Siberian Sturgeon populations because of its late maturity, long intervals between spawns and low productivity of northern water ecosystems is extremely slow. The recent decline in recruitment caused by decline in spawner abundance, damming and abnormalities in development and functioning of reproductive system will translate into a future decline in adult stock. Noting the longevity of this species, restoration of the stock is expected to take several generations. Although this species is listed on CITES Appendix II, further actions are urgently required to ensure wild populations of this species are sustained. Based on the estimated population declines over the past 60+ years and the expected continued declines into the future, this species has been assessed as EN A2bcd+4bcd.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population of Siberian Sturgeon is unknown. Direct counts and fishery statistics exist but are incomplete. However, a decline in catches of sturgeons within the main rivers of Siberia has been observed from the 1930s (Ruban 2005).

Based on commercial catch data, it is estimated that the Ob River basin contains more than 80% of the global population of this species (Chen 2007). In the Ob River basin, catches declined by ~99.5% from 1410 tonnes in 1935 to 6.7 tonnes in 1996. In the Yenisei River catches declined from 504 tonnes in 1934 to 10-12 tonnes in 2000s (a ~97.5% decline). In the Lena River catches declined from 190 tonnes in 1943 to about 10 tonnes in recent years (a ~94.5% decline) (Ruban 2005).

This species was extirpated from the northwest parts of Xin jiang province, China in the 1950s. The small population that remains here exists through stocking (Chen 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The population decline all over the species range is a result of overfishing, damming (Ob, Yenisei, Angara) and poaching. Currently commercial fisheries are banned in the basins of the Ob and Yenisei rivers and the Lake Baikal. A decline in area of occupancy was observed in upper reaches of the Ob, Yenisei and Lena rivers (Ruban 2005). Dam construction at the Ob River resulted in 40% of sturgeon spawning grounds being lost (Gundrizer et al. 1983). At the main sturgeon rivers of Siberia (Ob and Yenisei) the high level of poaching was noted (Krokhalevskii and Mikhalev pers. com.). At the Ob River, natural reproduction of the sturgeon has also declined due to a high level of abnormalities in development and functioning of reproductive system caused by water pollution (Ruban 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Endangered (EN) (A2bcd+4bcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The majority of 'conservation' measures historically in place for the Siberian Sturgeon were set up and controlled at local and national level. Their aims are often securing fishing rights, supporting local stock levels. The Ob River and Baikal Lake populations of the sturgeon are included in Red Data Book of Russian Federation. This means that commercial fishing of these populations is now prohibited.

The Siberian Sturgeon was listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) in 1998. An export permit can only be issued if the specimen was legally obtained and if the export will not be detrimental to the survival of the species.

For the last 10 years, eggs of this species (originating from Russia) are being reared in Chinese hatcheries and young are being released into the upper reaches of the Irtysh River, in the northwest part of Xin jiang province, China. No information is currently available on population numbers. This is being undertaken by the Ministry of Fisheries and Aquaculture (Chen 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; aquarium: public aquariums; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Siberian sturgeon

The Siberian sturgeon (Acipenser baerii) is a species of sturgeon in the Acipenseridae family. It is most present in all of the major Siberian river basins that drain northward into the Kara, Laptev and East Siberian seas, including the Ob, Yenisei (which drains Lake Baikal via the Angara River) the Lena and Kolyma rivers. It is also found in Kazakhstan and China in the Irtysh River, a major tributary of the Ob. The species epithet was named for the German Russian biologist Karl Ernst von Baer.

Taxonomy[edit]

Siberian sturgeon is typically subdivided into two subspecies.[1] However, recent studies suggest that Siberian sturgeon may be monotypic, forming continuous genetically connected populations throughout their vast range.[2]

The nominate taxon (A. baerii baerii) accounts for 80% of all Siberian sturgeon and resides in the Ob river and its tributaries. This subspecies migrates to mouth of the Ob river during the winter due to seasonal oxygen deficiency in the Ob River, and swim thousands of kilometers upstream to spawn.

The subspecies A. baerii baicalensis known as the Baikal sturgeon is a unique lake form found primarily in the northern end of Lake Baikal and migrates up the Selenga River to spawn.

A third form, "A. baerii stenorrhynchus", resides in the eastern Siberian rivers and displays two life history patterns: a more abundant migratory one which swims considerable distances (sometimes thousands of kilometers) upstream from estuaries and deltas to spawn, and a non-migratory form. This form is now considered to be a junior synonym of A. b. baerii.

Description and population status[edit]

Siberian sturgeon usually weigh approximately 65 kg, with considerable variability between and within river basins. The maximum recorded weight was 210 kg. As with all other acipenserids, the Siberian sturgeon are long-lived (up to sixty years), and late to reach sexual maturity (males at 11–24 years, females at 20–28 years). They spawn in strong current main stem river channels on stone or gravel substrates.[1]

The Siberian sturgeon feeds on a variety of benthic organisms such as crustaceans and chironomid larvae.

The species had been in steep decline in its natural range due to habitat loss, degradation and poaching.[1] Up to 40% of the Siberian sturgeon spawning habitat has been made inaccessible by damming. High levels of pollution in certain places has led to significant negative impacts on the reproductive development of gonads.[3]

Aquaculture[edit]

While wild catches of Siberian sturgeon have been generally declining, the Siberian sturgeon is increasingly farmed both for meat and to produce caviar from its roe. Because the Lena population of A. baerii completes its life cycle in freshwater and sexually matures relatively early, it is the most commonly original broodstock for captive bred specimens. The main producer of Siberian sturgeon caviar is France, while the largest meat producers are Russia and China.[4]

Female Acipenser baerii farm bred in Les, Vall d'Aran, Spain

References[edit]

  1. ^ a b c d Ruban, G. & Bin Zhu (2009). "Acipenser baerii". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 21 April 2011. 
  2. ^ Ruban, G.I. (1999). [The Siberian Sturgeon Acipenser baerii Brandt (Structure and Ecology of the Species)]. Moscow. GEOS publishers. Pp. 235 (in Russian).
  3. ^ Akimova, N.V. and Ruban, G.I. 2001. Reproductive System Condition and the Reason for Decreased Abundance of Siberian Sturgeon Acipenser baerii in the Ob’ River. Journal of Ichthyology 41(2): 177-181.
  4. ^ Jesús Matallanas, FIGIS Species Fact Sheets. Species Identification and Data Programme - SIDP. In: FAO Fisheries and Aquaculture Department [online]. Rome. Updated . [Cited 18 June 2010]. http://www.fao.org/fishery/culturedspecies/Acipenser_baerii/en

Sources and links[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!