Overview

Comprehensive Description

Lutjanus apodus :

MZUSP 65929 (2, 142-138), Bahamas , San Salvador Island.

  • Rodrigo L. Moura, Kenyon C. Lindeman (2007): A new species of snapper (Perciformes: Lutjanidae) from Brazil, with comments on the distribution of Lutjanus griseus and L. apodus. Zootaxa 1422, 31-43: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EDE9214C-AABF-4706-AA56-C303C37A6B3C
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Body wide and relatively thick with a sloping forehead and a large round eye and large terminal mouth. Dorsal-fin base long and anal-fin base short. Prominent dorsal, anal, and pelvic-fin spines and a large non-serrated preopercular spine.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occurs in shallow, clear, warm, coastal waters over coral reefs. Often near the shelter of elkhorn corals and gorgonians (Ref. 9710). Juveniles are encountered over sand bottoms with or without seagrass (Thalassia), and over muddy bottoms of lagoons or mangrove areas. Young sometimes enter brackish waters. Sometimes forms resting aggregations during the day. Feeds on fishes, shrimps, crabs, worms, gastropods and cephalopods. Considered a good food fish, it is marketed fresh or frozen (Ref. 55). Maximum length for female taken from Ref. 3093.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda, as far north as Massachusetts, USA, Bahamas, Gulf,of Mexico, Antilles, southward to Trinidad and northern Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda (Ref. 26938) to Trinidad and northern Brazil. Eastern Atlantic: Côte d'Ivoire to Equatorial Guinea (Ref. 10795).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 672 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

67.2 cm TL (male/unsexed; (Ref. 9626)); 57 cm FL (female); max. published weight: 10.8 kg (Ref. 26340)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Modal fin-ray counts of D-X,14 A-III,8 are shared among most of the regional Lutjanus species, including L. analis, L. apodus, L. cyanopterus, L. griseus, L. jocu and the deep-water snappers L. buccanella, L. campechanus, and L. vivanus. Transitional and juvenile L. apodus have a prominent pattern of vertical bars without a lateral spot. (DNA)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Snout long and pointed, mouth large. One of the upper pairs of canine teeth notably enlarged, visible when mouth is close. Preopercular notch and knob weak. Pectoral fins long, reaching the level of anus. Scale rows on back parallel to lateral line, at least anteriorly. Olive gray to brownish on upper back and sides, with eight narrow, pale vertical bars which may be faint or absent in large adults. A solid or broken blue line which may disappear with growth, runs under the eye.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MZUSP 65929 (2, 142-138), Bahamas , San Salvador Island.

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Pretransitional mostly-unmarked stage, usually from 10-15 mm SL: Body: Pretransitional larvae can have a few melanophores on the body just below the dorsal fin base where the future bars will develop: at the mid-spinous dorsal fin, the end of the spinous dorsal fin and under the mid-soft dorsal fin. There is a patch of melanophores along the anterior third of the dorsal midline of the caudal peduncle and a full-length band of melanophores along the ventral midline of the caudal peduncle extending forward and ending just before a single large melanophore underlying the pterygiophores of the last anal-fin rays. A bar pattern begins on the lower caudal peduncle as a patch without melanophores between two bars. There are a few deep melanophores at the very end of the lateral midline of the caudal peduncle. Head: Melanophores on the head consist of a patch overlying the brain and on the surface braincase and small melanophores around the tips of both the upper and lower jaw (in similar numbers). The opercular area is covered in iridescence extending down to the pelvic-fin insertion. The inner cleithral surface of the gill cavity is speckled with large melanophores and there are internal melanophores lining the dorsal aspect of the peritoneum extending down to the vent and overlain by a silvery camouflage layer. Fin Spines: The dorsal and anal-fin spines are relatively stout, with prominent internal reticulations. There are fine serrations along the anterior aspect of the anal-fin spines at this stage, but disappearing during transition. Fins: Melanophores on the dorsal-fin membranes are concentrated between the third and eighth dorsal-fin spines, predominantly on the distal half of the fin-ray membranes and typically sparing the membranes adjacent to the base of the fin. Some individuals have melanophores spreading down to meet the dorsal midline, but only behind the fourth and fifth spines and later the ninth and tenth spines (at the site of the future dark bars on the body). On the anal fin, there are melanophores along the base of the spines and membranes, spreading almost half-way up the second and third anal-fin spines. There are melanophores on the lower portion of the membrane between the last anal-fin spine and the first ray and the next membrane or two, followed by melanophores at the base of the membrane for the next few rays. There can be a few melanophores between the bases of the uppermost of the lower segmented caudal-fin rays and also on the lowest two or three segmented rays, often extending out along the rays. Pretransitional analogues: Pretransitional larvae (mostly-unmarked stage, usually from 10-15 mm SL) are separated from some other Lutjanus by having distinct serrations persisting on the anterior profile of the anal and dorsal-fin spines (but shared by L. griseus and L. jocu). L. apodus larvae are distinguished from the L. griseus type at this stage by having the dorsal-fin membrane melanophores concentrated on the distal portion of the membranes, only a small patch on the anterior third of the dorsal midline of the caudal peduncle, usually an incipient bar pattern on the lower caudal peduncle, similar numbers of melanophores on the tip of the upper and lower jaws, and often pigmentation along the longest pelvic-fin membrane. It is likely that pretransitional L. jocu cannot be separated from L. apodus.

Transitional stage: Early transitional L. apodus develop a pattern of bars on the body, beginning at the lower caudal peduncle where two dark bars first separate and then bars progressively develop from the caudal peduncle anteriorly. Each bar starts below the base of the dorsal fin and extends down with development. The mid-body bars begin with three patches of melanophores: the first under the fourth to sixth dorsal-fin spines, the second under the last two dorsal-fin spines and first dorsal soft rays and the third under the middle of the soft dorsal fin. Melanophores are limited to the outer half of the spinous-dorsal-fin membranes at first, but progressively extend down during transition. Before any stripes develop on the head, the tips of the upper and lower jaws are similarly speckled with small melanophores. Even on lightly-marked transitional larvae, there are some small melanophores on the thorax and the pelvic fin membranes. Early transitional larvae have serrations on the anterior aspect of the first two anal-fin spines, but these are usually lost midway through transition. Late transitional larvae have melanophores covering much of the body, but now the bars are made up of alternating areas of smaller and larger melanophores. The lower caudal peduncle at this stage has filled-in with melanophores and no longer has bars separated by non-pigmented skin. By this point, melanophores have advanced down the spinous-dorsal-fin membranes and do reach the base where they merge with the melanophores of the darker bars. On the head, a stripe develops between the eye and the tip of the upper jaw and two stripes diverge behind the eye. Small melanophores fill in and uniformly speckle the cheek, operculum, and thorax as well as the pelvic fins. Transitional analogues: Transitional L. apodus larvae develop bars on the body with no lateral spot, distinguishing them from the spotted species. In the early stages of transition, L. apodus larvae can be separated from L. griseus by having incipient melanophore bars forming on the lower caudal peduncle (vs. uniform) and having melanophores mostly on the distal half of the spinous-dorsal-fin membranes (vs. proximal and base). Late transitional L. apodus larvae differ from L. griseus by having distinct vertical bars of larger melanophores on the body vs. uniform speckling over the upper body (and lighter over the lower half of the head and abdomen) or indistinct bars at most on the upper half of the body, numerous melanophores speckling the cheek, thorax, and pelvic fins (vs. those areas relatively lightly-marked). Transitional recruits of L. jocu can overlap in appearance and can show a similar bar pattern to that of transitional L. apodus, although the lighter bars are narrower and the bar pattern becomes less distinct with development. There is also some overlap in appearance when both have a mostly-uniform speckling pattern, although uniform L. apodus have large melanophores and L. jocu have a fine speckling of melanophores (for example, in the space below the eye, there are about 100 melanophores in an area equal to the pupil in L. jocu vs. about 10 in L. apodus). Transitional recruits of L. apodus and L. griseus can sometimes overlap in appearance. If the bars are distinct from the base of the dorsal fin down to the anal fin, it is L. apodus; when L. griseus have bars, they are apparent on the upper body but fade towards the anal-fin base. As they grow, L. griseus develop distinct striping patterns on the lower body that do not occur on L. apodus.

Juveniles: Juvenile L. apodus have prominent vertical bars and no lateral spot. Rare individuals have a uniform pattern with only indistinct bars, but, notably these individuals do not show any striping pattern. Juvenile analogues: The absence of a lateral spot separates L. apodus from most other juvenile snappers ((L. analis, L. mahogoni, L. synagris, and the deep-water snappers). Virtually all juvenile L. apodus have prominent vertical bars which are absent or indistinct in L. jocu, L. griseus, and L. cyanopterus. Rare individuals of L. apodus that have a uniform appearance or indistinct bars can be difficult to separate from juvenile L. jocu, but juvenile L. griseus of the same size would show some evidence of body stripes. Juvenile L. cyanopterus are narrower-bodied, have a wider caudal peduncle, and do not share the blue line under the eye.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 2 - 63 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1517 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1145 samples.

Environmental ranges
  Depth range (m): 0 - 46
  Temperature range (°C): 26.007 - 28.503
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 34.217 - 37.096
  Oxygen (ml/l): 4.285 - 4.748
  Phosphate (umol/l): 0.046 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 46

Temperature range (°C): 26.007 - 28.503

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 34.217 - 37.096

Oxygen (ml/l): 4.285 - 4.748

Phosphate (umol/l): 0.046 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 63m.
From 2 to 63 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in shallow, clear, warm, coastal waters over coral reefs. Often near the shelter of elkhorn corals and gorgonians (Ref. 9710). Juveniles are encountered over sand bottoms with or without seagrass (Thalassia), and over muddy bottoms of lagoons or mangrove areas. Young sometimes enter brackishwaters. Sometimes forms resting aggregations during the day. Feeds on fishes, shrimps, crabs, worms, gastropods and cephalopods. Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus cf. apodus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus cf. apodus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lutjanus apodus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 47 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGATATCGGCACCCTTTATCTCGTATTCGGTGCTTGAGCCGGAATAGTAGGCACAGCCTTAAGCCTGCTCATTCGAGCAGAGCTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCATTAATGATCGGAGCCCCCGACATGGCATTCCCCCGAATGAATAACATGAGCTTTTGACTTCTTCCCCCATCCTTCCTACTACTACTCGCCTCCTCTGGAGTAGAAGCCGGTGCCGGAACGGGATGAACAGTTTATCCTCCCTTAGCAGGAAATCTAGCACACGCAGGAGCGTCTGTAGACCTAACCATTTTCTCCCTCCACCTAGCGGGTGTTTCTTCAATTCTAGGGGCCATCAACTTTATTACAACAATCATCAACATGAAACCTCCCGCCATCTCACAATATCAAACACCACTATTCGTTTGAGCCGTCCTAATCACTGCTGTTCTACTTCTTCTGTCCCTTCCCGTACTAGCTGCCGGAATTACAATGCTCCTTACAGATCGAAATCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTCGGCCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus apodus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 61
Specimens with Barcodes: 85
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Principal threats

Studies at the Saba Reef, one of the richest fish assemblages in the Caribbean Basin, have indicated the chief threats to the dogtooth snapper and other reef fishes are overfishing and the residual impacts of the particular chemical dispersant used by the USA in the aftermath of the Deepwater Horizon oil spill; this chemical has high persistence and known toxicity to a gamut of marine fauna. Studies by Burke et al. suggest that concentrations of dispersant and other water pollutants are of particular concern in critical lagoon nurseries; these studies suggest that the toxicity of residual dispersant may be much more significant to reef fishes than the actual petroleum release of an underwater oil spill.

  • Mark McGinley. 2011. Schoolmaster. topic ed. C.Michael Hogan. Ed.-in-chief Cutler J.Cleveland. Encyclopedia of Earth. National Council for Science and Environment. Washington DC http://www.eoearth.org/article/Schoolmaster
  • J.S.Burke, W.J.Kenworthy and L.L.Wood. 2009. Ontogenetic patterns of concentration indicate lagoon nurseries are essential to common grunts stocks in a Puerto Rican bay. Worldwide Science.org
  • Jeffrey T. Williams, Kent E. Carpenter, James L. Van Tassell, Paul Hoetjes, Wes Toller, Peter Etnoyer, Michael Smith. 2010. Biodiversity Assessment of the Fishes of Saba Bank Atoll, Netherlands Antilles. PloS One. 5(5): e10676.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Schoolmaster snapper

The schoolmaster snapper, Lutjanus apodus, is a colorful, subtropical fish found over coral reef areas along the coasts of Florida, the Bahamas, and the Caribbean, though it can range northward along the Atlantic coast of the United States.[1] Adults are 12-14 in (30-35 cm) long and weigh 1.0-2.0 lb (0.4-0.8 kg), though rare individuals can weigh 8 lb at 24 in long. It has a robust, slightly compressed body, with a pointed head. Its color varies from silvery to bronze. Fins and tails are yellow and the snout contains blue stripes. As the common name suggests, schoolmaster snapper live in groups of dozens of subjects. They keep a short distance from the sea floor at depths between 10 and 90 ft, prefer the cover provided by coral reefs during the day, and expand their range to seagrass beds at night. The schoolmaster snapper is sometimes called the barred snapper or the caji. Like other snapper species, it is a popular food fish.

Yellow tail snapper.JPG

Distribution[edit]

The schoolmaster snapper is found in coastal areas of Florida, the Bahamas, and the Caribbean. It lives in shallow, clear, warm, coastal waters over coral reefs, sand with plants, and mud in mangrove areas or other reef-associated bottom types. Juveniles stay over sand bottoms with or without seagrasses, and over muddy bottoms of lagoons or mangrove areas. The young tend to be in littoral (shore) areas, grass plains and from time to time enter briny waters. They may be seen resting in accumulations during the day. The groups of juveniles in shallow coastal waters, as they grow, move into deeper and deeper water. Large schools are often noticed by divers over shallow wrecks and certain coral patches, and this behavior inspired the common name.

Adults usually stay near shore at depths ranging from 0 to 200 ft (2-60 m) and shelter around elkhorn and gorgonian coral. Large adults are sometimes found on the continental shelf. Typical depths are up to 12 ft (4 m).[2] reported that at night, schoolmaster snapper may increase their range to twice the daytime range, mostly by visiting seagrass beds.

Characteristics[edit]

The schoolmaster snapper has a husky, moderately deep body with a pointed head. Its thickness can be more than a third of its standard length. The head is large, and as long as the body is thick; the representation is straight from snout to the backside, and regularly curved to the large, unforked tail. Its triangular snout is long and pointed, with a large mouth. One of the upper pairs of canine teeth is clearly larger than back teeth in the lower jaw and can be seen when mouth is closed. There are 40 to 45, usually 42 to 44, tubed scales in the lateral line. The interior scale rows on back are parallel to lateral line.

The soft dorsal and anal fins have scales. The single dorsal fin has 10 spines and 14 soft rays; the spiny portions of the fin are not deeply engraved at the junction with the soft portion. The anal fin has three spines and eight soft rays that are rounded from the tail. The caudal fin is emarginated. The 16 or 17 rays of the pectoral fins are longer than the distance from longest point of the snout to tail edge of preopercle, reaching the level of anus.

The color is olive gray to brownish on upper back and upper sides, with yellow to reddish mite around the head. The lower sides and belly are lighter; there is no dark lateral spot below the anterior part of soft dorsal fin. There are 8 narrow, light vertical bars on the side of the body which may be faded or absent in large adults. A solid or broken blue line runs beneath the eye; it may also disappear with growth. From the upper jaw to the tip of the fleshy opercle, the line is often broken into parts that resemble dashes and spots. The fin and tail is bright yellow, yellow green, or pale orange, and the snout contains blue stripes.

Rooker reported the diet of small L. apodus (<70 mm) consisted of crustaceans (more than 90%), specifically amphipods and crabs. Larger schoolmaster snapper preferred smaller fish (more than 50% by weight) and also ate crabs, shrimp, and stomatopods. He attributed the difference in eating habits to the fact that the bigger fish could open their jaws wider for bigger prey.[3]

Reproduction and growth[edit]

Schoolmaster snapper are gonochorist, meaning males and females are separate. They spawn over most of the year, with the majority of the spawning happening during middle to late summer. They spawn during April-June off Cuba. They reproduce by spawning in open water with both male and female fish releasing their gametes at the same time. The fertilized eggs then settle to the bottom, where they are left unguarded.

Most mature schoolmaster snapper average a pound (0.4 kg) or less in shallow water. Big individuals on the deep reefs may reach six or seven pounds. They can grow up to 8 lb and 24 in (62 cm) long, but individuals 12-14 inches (35 cm) long are more commonly observed.

Weight:length relationship for schoolmaster snapper L. apodus[4]

As fish grow longer, they increase in weight, but the relationship is not linear. The relationship between length (L) and weight (W) for nearly all species of fish can be expressed by an equation of the form:

W = cL^b\!\,

Invariably, b is close to 3.0 for all species, and c varies between species. A weight-length relationship based on 100 schoolmaster snapper ranging in length from 2 to 7 in (50 mm to 180 mm) [5] found the coefficient c was 0.000050015 and the exponent b was 2.9107. This relationship suggests a 12.5-inch schoolmaster snapper (320 mm) will weigh about 2.2 lb (1 kg).

Commercial and recreational use[edit]

Schoolmaster snapper, along with other snapper species, are sought by both recreational and commercial fishermen. Their food quality is reported to be excellent.

Fishing regulations in US state waters are specific to each state, but they have similarities. For example, the minimum length in Florida for schoolmaster snapper is 10 in (about 25 cm) total length with a catch limit of 10 per fisherman per day. However, the 10-fish limit is an aggregate for all species of snapper.[6] Louisiana and South Carolina have similar limits except the minimum length is 12 in (about 30 cm) total length, and nonstainless steel circle hooks and natural bait are required.[7] These regulations are consistent with current US guidelines for schoolmaster snapper caught in federal waters.[8] The guidelines change from time to time. In certain marine protected areas,[9] fishing is not allowed to help specific species maintain or recover healthy populations.

Light spinning and baitcasting tackle are used to fish for schoolmaster snapper. Live shrimp and baitfish, as well as shrimp pieces and cut bait, are the best natural bait. While jigs make for the best artificial bait, artificials are rarely used and rarely successful.

Similar species[edit]

Larger schoolmaster snapper whose white vertical bars are faded might be mistaken for dog snapper. The schoolmaster, however, does not have the white cone-shaped patch on the gill that identifies the dog snapper. Though different in appearance, schoolmaster snapper have habits similar to those of the mangrove snapper.

References[edit]

  1. ^ FishBase.org page on Schoolmaster Snapper
  2. ^ Nocturnal migration patterns of two Caribbean reef fishes, Haemulun sciu and Lutjanus apodus. Steven Hitt, Center for Marine and Environmental Studies, University of the Virgin Islands, accessed 20 February, 2012.
  3. ^ Rooker, JR. Feeding ecology of the schoolmaster snapper, Lutjanus apodus (Walbaum), from southwestern Puerto Rico. Bulletin of Marine Sciences 56(3):881-894, 1995.
  4. ^ Valentine-Rose L, Layman CA, Arrington DA, Rypel AL. Habitat fragmentation decreases fish secondary production in Bahamian tidal creeks. Bulletin of Marine Science 80(3):863-877, 2007
  5. ^ Valentine-Rose L, Layman CA, Arrington DA, Rypel AL. Habitat fragmentation decreases fish secondary production in Bahamian tidal creeks.Bulletin of Marine Science 80(3):863-877, 2007
  6. ^ Florida fishing regulations for snapper species accessed 20 February, 2012
  7. ^ South Carolina saltwater fishing regulations accessed 20 February, 2012
  8. ^ South Atlantic Fishery Management Council Recreational fishing regulations for snapper. South Atlantic Fishery Management Council Commercial fishing regulations for snapper. Accessed 20 February, 2012
  9. ^ Marine Protected Areas
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!