Overview

Comprehensive Description

Biology

In fresh waters, occurs in rivers and lakes (Ref. 89241). Adults inhabit coastal and estuarine waters (Ref. 59043). Ammocoetes occur along river banks in silty-muddy substrate where current is slight (Ref. 89241). Prefer sites with stony or sandy bottom, shaded by riparian vegetation (Ref. 41072). Spawning adults found in gravel riffles and runs of clear streams; feeding adults usually in oceans or lakes; ammocoetes in muddy margins and backwaters of river and lakes (Ref. 5723). Spawning occurs on pebble-sand substrate (Ref. 89241). Anadromous (Ref. 58426, 89241). The Great Slave Lake Basin population is believed to be a permanent freshwater resident population (Ref. 89241). There are non-migratory freshwater populations. Probably parasitizes any species of fish of suitable size (Ref. 27547), including commercial species (Ref. 58426). Subadults are non-parasitic (Ref. 12218). Feed on small aquatic invertebrates, algae and organic matter contained in detritus (Ref. 41072). Larval period lasts 4 years. Age classes range in total length approximately as follows: 0+ up to 35 mm; 1+ 30-65 mm; 2+ 60-155 mm; 3+ 150-220 mm. They tend to disperse downstream as they age. Mean densities in the Hay River, Northwest Territories, have been estimated at 137 ammocoetes/m2. Larvae feed mainly on organic detritus and algae. Ammocoetes are preyed upon by fishes. Metamorphosis begins in late summer (mid-August) and continues through the winter in Great Slave Lake Basin, Northwest Territories, Canada and recently metamorphosed adults enter the lake in May to July. Downstream movement of recently metamorphosed adults towards the sea begins in late May and ends in July in Kamchatka. Adults parasitic on various fishes in both fresh and marine waters. The site of attachment is usually below the lateral line and anterior to the pelvic fins. Adults are preyed upon by fishes and birds (gulls). Spawning adults ascend rivers in Japan between October and January, while this occurs between the end of May and June in Utkholok River Basin, Kamchatka, and between the end of November and the end of April in the Yukon River, Alaska. The spawning migration distance up the Yukon River exceeds 1,600 km. Both sexes participate in the building of the oval-shaped redd. Spawning occurs in June in Utkholok River Basin, Kamchatka, from April to July in Japan and mid June - early July in Great Slave Lake Basin, Canada. Fecundity, 9,790-29,780 eggs/female in Great Slave Lake Basin (believed to be a permanent freshwater resident population), 12,272-34,586 eggs/female in an anadromous population from Kamchatka, and 62,936-119,180 eggs/female in anadromous populations from rivers in Japan. In the latter case, the long diameter of the eggs varies from 0.85 to 1.23 mm and the short diameter from 0.75 to 1.14 mm. The eggs are dark blue and adhesive. When they emerge from the egg after about a one-month incubation period, larvae measure about 7 mm total length. Adult life is about two years (Ref. 89241). Arctic lamprey has high quality flesh rich in fat (Ref. 41072). Around 1879 it was of great importance for native peoples along the Yukon River at Russian Mission and Anvik, Alaska, where they would catch upstream spawning migrants by the dozens through the ice using long multi-forked poles or dipnets (Turner, 1886, Nelson, 1887). The oil in the lamprey would be rendered through boiling in water and used for human food or in lamps as a substitute for seal oil. Recently, there has been an interest in starting a commercial fishery for upstream migrants targeting the Asian market in the USA and abroad in addition to the traditional subsistence harvest. The 2003 quota was set at 20,000 kg. The taste has been compared to that of sardine because of the high lipid content that can reach 38% of the body weight. In Japan, in the Shinano River estuary, upstream spawning migrants are caught between October and January using large handnets; in 1959, daily catches varied from a few dozen to over 1,000 lampreys (Honma 1960). In winter, lampreys are caught at the same place but using a gang of about ten bell-shaped leather fishing traps that is laid in a string along the river floor (Honma, 1960). The lampreys are served in a number of different ways in restaurants, and in salt-dried form are highly valued as a medicine against night blindness (Honma, 1960) (Ref. 89241).
  • Kottelat, M. 1997 European freshwater fishes. Biologia 52, Suppl. 5:1-271. (Ref. 13696)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The almost circumpolar range extends from Lapland eastward to Kamchatka, Russia, and south to Japan and Korea; also the Arctic and Pacific drainages of Alaska and northwestern Canada from the Anderson River and Mackenzie River drainage, Northwest Territories and northern Alberta (south to Great Slave and Artillery lakes), west and south to the Kenai Peninsula, Alaska (McPhail and Lindsey 1970, Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The almost circumpolar range extends from Lapland eastward to Kamchatka, Russia, and south to Japan and Korea; also the Arctic and Pacific drainages of Alaska and northwestern Canada from the Anderson River and Mackenzie River drainage, Northwest Territories and northern Alberta (south to Great Slave and Artillery lakes), west and south to the Kenai Peninsula, Alaska (McPhail and Lindsey 1970, Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar; Europe, Asia and North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic: Siberian coast to Anderson River in Canada. Northwest Pacific: Bering Sea south to Japan and Korea. Freshwater resident populations in Slave, Hay and Mackenzie rivers, Northern Territories, Canada. Freshwater non-migratory stocks in river systems in Mongolia (Ref. 41072). Europe: Arctic, White and Barents Sea basins of Russia and Norway, from Pechora drainage in Russia to Pasvik drainage in Norwegian-Russian border (Ref. 59043). In danger of local extinctions due to pollution and use as bait (Ref. 12321).
  • Vladykov, V.D. 1984 Petromyzonidae. p. 64-67. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and Mediterranean. UNESCO, Paris. vol. 1. (Ref. 3161)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 23 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

63.0 cm TL (male/unsexed; (Ref. 56557)); max. published weight: 200 g (Ref. 56557); max. reported age: 7 years (Ref. 12321)
  • Novikov, N.P., A.S. Sokolovsky, T.G. Sokolovskaya and Y.M. Yakovlev 2002 The fishes of Primorye. Vladivostok, Far Eastern State Tech. Fish. Univ., 552 p. (Ref. 56557)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by 2 large teeth on the supraoral bars, the presence of only 2 points on the central pair of lateral tooth plates, and the presence of a row of posterial teeth (Ref. 27547). Dorsal fins arise far back on body, the anterior dorsal lower than the posterior, the fins higher in males; lower lobe of caudal fin is somewhat larger than upper, the fin joined to both dorsal and anal fins; anal fin small, in males represented only by a low ridge (Ref. 27547). Color ranges from brown to olive to grayish above, paler below (Ref. 27547). The non-anadromous form rarely grows larger than 18 cm (Ref. 27547). Other adult diagnostic features: 11.0-62.5 cm TL. Wet weight of individuals 14.5-35.0 cm TL, 3.2-87.7 g. Body proportions, as percentage of TL (based on 63 specimens measuring 13-46 cm TL): prebranchial length, 7.3-21.3; branchial length, 7.8-20.8; trunk length, 21.9-56.3; tail length, 24.6-30.8; eye length, 0.7-3.7; disc length, 4.5-7.7. Intestinal diameter up to 13 mm. Urogenital papilla length, as a percentage of branchial length, in 6 spawning males measuring 33.9-40.1 cm TL, 14.6-19.5. Trunk myomeres, 65-77 [Kucheryavyi et al. (2007) reported counts of 63-85 for 19 downstream migrants and 55-79 for 87 anadromous individuals from Utkholok River Basin, Kamchatka]. Dentition: supraoral lamina, 2 unicuspid, rarely bicuspid, teeth; infraoral lamina, 6-10 teeth, usually 8 (as few as 5), the lateralmost tooth on either end usually bicuspid, the internal ones unicuspid; usually 3, rarely 4 endolaterals on each side; endolateral formula typically 2-2-2 with variant formulae, 2-2-1, 2-2-2-2, 2-2-2-1; 3 rows of anterials; first row of anterials, 3 unicuspid teeth; total number of anterials, 20-33 teeth [5-43 according to Kucheryavyi et al. (2007) and as low as 11 according to Iwata et al. (1985), which may be due to regional effects, but this requires further investigation]; exolaterals absent; single row of posterials, 12-28 teeth; transverse lingual lamina, 13-18 teeth, the median one greatly enlarged; longitudinal lingual laminae each with 10-14 teeth. Velar tentacles, 5-7, with tubercles and with the single median tentacle shorter than the lateral tentacles immediately next to it, and with dorsal velar wings on either side, each consisting of a single tentacle. Body coloration (live) of recently transformed adults brown on dorsal and lateral aspects and silvery on ventral aspect, while upstream spawning migrants have a yellowish olive dorsal aspect, becoming lighter on the lateral aspects, and dull yellowish on the ventral aspect. Lateral line neuromasts unpigmented. Gular region unpigmented. Second dorsal fin with a dark blotch near the apex. Extent of caudal fin pigmentation, 1% to
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Lampetra camtschatica
Catalog Number: USNM 21524
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): L. Turner
Locality: Anvik Yukon R. Alaska, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Both anadromous and strictly freshwater forms exist. In the nonbreeding season, anadromous forms are at sea, freshwater forms in lakes or larger rivers. Ammocoetes burrow into soft stream margins and beds of silty mud in backwaters. Spawning occurs in clear streams of moderate flow, out of the main current, in depression or pit constructed by both sexes in gravel.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Both anadromous and strictly freshwater forms exist. In the nonbreeding season, anadromous forms are at sea, freshwater forms in lakes or larger rivers. Ammocoetes burrow into soft stream margins and beds of silty mud in backwaters. Spawning occurs in clear streams of moderate flow, out of the main current, in depression or pit constructed by both sexes in gravel.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 50 m (Ref. 50610)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Russian Academy of Sciences 2000 Catalog of vertebrates of Kamchatka and adjacent waters. 166 p. (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 8.5 - 55
  Temperature range (°C): -0.055 - -0.055
  Nitrate (umol/L): 7.786 - 7.786
  Salinity (PPS): 32.770 - 32.770
  Oxygen (ml/l): 6.159 - 6.159
  Phosphate (umol/l): 1.173 - 1.173
  Silicate (umol/l): 27.397 - 27.397

Graphical representation

Depth range (m): 8.5 - 55
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Transformed lampreys move downstream to sea, lake, or larger river August-November. Adults migrate upstream to spawn in spring. Migrating adults often seen in vast swarms, particularly at obstructions (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Prefers sites with stony or sandy bottom, shaded by riparian vegetation (Ref. 41072). Spawning adults found in gravel riffles and runs of clear streams; feeding adults usually in oceans or lakes; ammocoetes in muddy margins and backwaters of river and lakes (Ref. 5723). Anadromous (Ref. 58426). There are non-migratory freshwater populations. Subadults are non-parasitic (Ref. 12218). Feed on small aquatic invertebrates, algae and organic matter contained in detritus (Ref. 41072).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Ammocoetes filter-feed on microscopic plants and animals. Adults parasitize and consume body juices of various fishes. Some freshwater populations have blunt teeth and may be nonparasitic. (Scott and Crossman 1973, Morrow 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but apparently quite large (likely greater than 100,000). This species is considered the most commonly occurring lamprey in Alaska, it is often locally abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Preyed on by various predatory fishes, also by gulls, especially when in migratory concentrations in shallow streams. Lowering stream levels in late spring and summer may strand ammocoetes in dry stream edges. (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Both male and female engage in nest building, removing pebbles and small rocks from the stream bottom. The male uses his sucker to attach himself to the head of the female. The pair arch their bodies and the male wraps himself around the female. Both of the lampreys vibrate rapidly and eggs and sperm are extruded into the nest. Two males may simultaneously mate with a single female. A female will mate several times before her egg supply is exhausted, usually with several males. Ammocoetes spend one to two years in this stage. Upon metamorphosis (occurring from fall through winter, Ref. 12218), the young adults descend the stream to the sea or lakes or larger rivers (occurring in springtime, Ref. 12218) (Ref. 27547).
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns late May-early July at water temperature of 12-15 C. Female may spawn with more than one male. Eggs hatch within a few weeks. Ammocoete stage lasts at least 1 year, possibly up to 4 year. Metamorphosis occurs in fall (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lethenteron camtschaticum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATTTTTTGGGGCTGAGCAGGAATAGTGGGAACCGCTTTAAGCATCCTAATTCGAGCAGAACTCAGTCAACCGGGTACTTTACTAGGAGATGACCAGATCTTTAATGTTATCGTAACCGCTCATGCTTTCGTTATAATTTTTTTTATAGTCATACCAATTATAATCGGAGGCTTCGGAAACTGACTTGTGCCTATAATACTTAGCGCCCCTGATATAGCCTTCCCACGTATAAATAACATAAGCTTTTGACTGCTCCCACCATCCCTACTCTTACTTTTAGCTTCCGCAGGAGTTGAAGCAGGAGCCGGAACTGGATGAACAGTATACCCACCTCTAGCAGGAAATTTAGCCCACACAGGGGCCTCTGTTGACTTAACAATTTTCTCCCTTCATCTAGCCGGTATTTCATCAATCCTTGGGGCAGTCAACTTTATTACAACAATTTTTAACATAAAACCTCCAACTATAACACAATACCAAACCCCATTATTTGTATGATCCGTTTTAATTACTGCAGTCCTCCTTCTTCTATCACTTCCTGTACTTGCAGCTGCCATCACTATACTTTTAACAGATCGTAATTTAAATACATCCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lethenteron camtschaticum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s
Freyhof, J. & Kottelat, M.

Justification
Listed as Least Concern because extent of occurrence, number of subpopulations, and population size are relatively large, and because the species probably is not declining fast enough to qualify for any of the threatened categories.

History
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Wide range in the northern hemisphere; apparently secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but apparently quite large (likely greater than 100,000). This species is considered the most commonly occurring lamprey in Alaska, it is often locally abundant.

Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats to spawning habitat include pollution and water flow regulation or dams. Since little is known about local abundance and population trends, there is the potential for overharvest in subsistence and commercial fisheries. Lampreys appear to have habitat needs and life histories similar to anadromous salmon; therefore, in areas where salmon populations are declining, lampreys may also be at risk. The U.S.-Canadian lamprey control program focuses on eradication of the invasive sea lamprey (Petromyzon marinus) in the Great Lakes region and is not generally a threat to Arctic lamprey throughout the North American range. In Europe the species may be threatened by industrial pollution of spawning streams and capture of ammocoetes for use as bait (Lelek 1987, Renaud 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Threats to spawning habitat include pollution and water flow regulation or dams. Since little is known about local abundance and population trends, there is the potential for overharvest in subsistence and commercial fisheries. Lampreys appear to have habitat needs and life histories similar to anadromous salmon; therefore, in areas where salmon populations are declining, lampreys may also be at risk. The U.S.-Canadian lamprey control program focuses on eradication of the invasive sea lamprey (Petromyzon marinus) in the Great Lakes region and is not generally a threat to Arctic lamprey throughout the North American range. In Europe the species may be threatened by industrial pollution of spawning streams and capture of ammocoetes for use as bait (Lelek 1987, Renaud 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Taxonomic status needs clarification; genetic studies are needed to better define the relationship between L. alaskensis and L. appendix. Understanding of taxonomic status and evolutionary history of this and other lamprey species may be improved by study of permanent freshwater populations and their relationship to anadromous life-forms of the same species (although no permanent freshwater populations of the Arctic lamprey are known from North America), as well as satellite species.

Effects of parasitism on host species populations need further study.

It would be useful to compile existing data (e.g., commercial fish records, subsistence harvest documentation) from throughout the range to better assess population status (ADFG 2005). Surveys should be conducted at index locations to gauge population trend.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Taxonomic status needs clarification; genetic studies are needed to better define the relationship between L. alaskensis and L. appendix. Understanding of taxonomic status and evolutionary history of this and other lamprey species may be improved by study of permanent freshwater populations and their relationship to anadromous life-forms of the same species (although no permanent freshwater populations of the Arctic lamprey are known from North America), as well as satellite species. Effects of parasitism on host species populations need further study.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; bait: usually
  • Vladykov, V.D. 1984 Petromyzonidae. p. 64-67. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and Mediterranean. UNESCO, Paris. vol. 1. (Ref. 3161)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arctic lamprey

The Arctic lamprey (Lethenteron camtschaticum) is a species of lamprey, a jawless fish in the order Petromyzontiformes. It inhabits coastal freshwater habitat types in the Arctic.[2] Some populations are anadromous, spending part of their lives in the ocean. It is the most common and widespread lamprey in the Arctic region.[3]

Description[edit]

This lamprey is usually about 13 to 32 centimetres (5.1 to 12.6 in) long, but specimens have been known to reach 63 centimetres (25 in) and 200 grams (7.1 oz) in weight. Non-anadromous individuals are rarely over 18 centimetres (7.1 in) long.[2] It is brown, gray, or olive in color with a paler belly. There are two dorsal fins located near the tail, the posterior one larger than the anterior. They are larger in the male than in the female. The caudal fin has two lobes, the lower longer than the upper. It is continuous with the dorsal and anal fins. The anal fin of the male takes the form of a small ridge.[2]

Distribution and habitat[edit]

The Arctic lamprey is a circumpolar species. Its range extends from Lapland eastward to Kamchatka and southward to Japan and Korea. It also inhabits the Arctic and Pacific drainages of Alaska and northwestern Canada. The adults live in freshwater habitat near the coast, such as rivers and lakes. It can be found over stony and sandy substrates, and shelters under vegetation.[1]

Behaviour[edit]

The adult Arctic lamprey spawns in the gravel of riffles. The ammocoetes, as the lamprey larvae are known, are found in muddy freshwater habitats where they burrow in the mud and feed on detritus. It is generally an anadromous species, living in the ocean before migrating to fresh water to spawn, but some populations are permanent residents of fresh water.[2]

The adult is generally a parasitic feeder that attaches to any of a number of other fish species,[2] including salmon, lake trout, and lake whitefish.[4] The smaller, non-migratory form is not parasitic.[4] The juvenile consumes aquatic invertebrates, algae, and organic debris.[2] This species is prey for other fish such as inconnu, northern pike, and burbot, and gulls feed on spawning aggregations. The eggs and larvae are food for sculpins.[4]

Status[edit]

The Arctic lamprey is a commercially important edible fish with fatty flesh. It is reared in aquaculture.[2] The ammocoetes are used as bait. Threats to the spawning habitat of this species include pollution and the regulation of water flow by damming. Nevertheless, the IUCN has assessed this species as being of "Least Concern".[1]

References[edit]

  1. ^ a b c NatureServe. 2013. Lethenteron camtschaticum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Downloaded on 15 October 2013.
  2. ^ a b c d e f g Froese, R. and D. Pauly. (Eds.) Lethenteron camtschaticum. FishBase. 2011.
  3. ^ Arctic Lamprey: Lethenteron camtschaticum. Arctic Ocean Diversity.
  4. ^ a b c Arctic Lamprey, Lampetra japonica. Canada's Polar Life.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Systematics and nomenclature are debated; previously this species was recognized as Lampetra japonica; current correct name is L. camtschatica (see sources in Mecklenburg et al. 2002). Subgenus is Lethenteron, which has been regarded as a distinct genus by some authors (e.g., Hardisty and Potter 1971, but not Page and Burr 1991 or Robins et al. 1991). This species is closely related and likely ancestral to the nonparasitic American brook lamprey, Lampetra appendix (synonym: L. lamottenii) and Alaskan brook lamprey, L. alaskensis (Docker et al. 1999, Mecklenburg et al. 2002).

Recent genetic data (mitochondrial cytochrome b) indicate that L. camtschatica and L. alaskensis are genetically identical (L. alaskensis is considered a derivative or satellite species of L. camtschatica; Lang, pers. comm.). However, if life history is not a valid criterion for defining species, then on basis of morphology and genetic similarity all three species mentioned (L. appendix, L. camtschatica and L. alaskensis) may be referred to as L. camtschatica (Mecklenburg et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!