Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

A cryopelagic species associated with the underside of ice. An anti-freezing substance enable Individuals to tolerate sub-zero temperature (Ref. 33215). Adults feed on copepods and krill (Ref. 5179). Sexually mature individuals spawn once a year (Ref. 89319). Larval pelagic phase is long (Ref. 89319).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern Ocean: Ross, Davis and Weddell Sea, Vincennes Bay, Budd Coast, Antarctic Peninsula, South Orkney and South Shetland islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4 - 7; Dorsal soft rays (total): 34 - 38; Analsoft rays: 30 - 35
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 280 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 5179))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Yellowish with dark spots, irregular crossbars. Dorsal and caudal with series of spots sometimes (Ref. 11892).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Trematomus borchgrevinki Boulenger
Catalog Number: USNM 50566
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1899
Locality: Cape Adare, Surface, Antarctica, Pacific
  • Syntype: Boulenger, G. A. 1902. Report on the collections of natural history made in the Antarctic regions during the voyage of the "Southern Cross.". Pt 5: 179, pl. xii.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 0 - 550 m (Ref. 11892), usually 0 - 30 m (Ref. 5179)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 234 specimens in 1 taxon.
Water temperature and chemistry ranges based on 103 samples.

Environmental ranges
  Depth range (m): -1 - 588
  Temperature range (°C): -1.715 - -1.096
  Nitrate (umol/L): 22.800 - 32.156
  Salinity (PPS): 33.660 - 34.552
  Oxygen (ml/l): 6.783 - 8.610
  Phosphate (umol/l): 1.246 - 2.300
  Silicate (umol/l): 21.227 - 102.460

Graphical representation

Depth range (m): -1 - 588

Temperature range (°C): -1.715 - -1.096

Nitrate (umol/L): 22.800 - 32.156

Salinity (PPS): 33.660 - 34.552

Oxygen (ml/l): 6.783 - 8.610

Phosphate (umol/l): 1.246 - 2.300

Silicate (umol/l): 21.227 - 102.460
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Trematomus borchgrevinki (Trematomus borchgrevinki, Pleurogramma antarctica) is prey of:
Actinopterygii
Leptonychotes weddellii

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Trematomus borchgrevinki (Trematomus borchgrevinki, Pleurogramma antarctica) preys on:
Orchomonopsis
Copepoda
Euphausia superba
Euphausia crystallorophias

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pagothenia borchgrevinki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAACAGCCCTTAGCCTGCTCATTCGAGCAGAACTTAGTCAACCCGGCGCCCTGTTGGGGGATGACCAAATTTATAATGTAATTGTTACCGCTCACGCTTTCGTAATGATTTTCTTTATGGTGATGCCAATCATAATTGGAGGTTTTGGAAACTGACTTATCCCCCTTATGATTGGGGCCCCCGATATGGCTTTTCCTCGAATAAATAATATGAGCTTTTGGCTTTTACCGCCCTCCTTTCTGCTCTTGCTAGCTTCGTCAGGTGTTGAAGCTGGGGCAGGGACAGGGTGAACTGTTTACCCTCCCCTCTCTGGGAATTTAGCCCATGCAGGGGGTTCTGTTGATTTAACTATTTTTTCCCTTCATTTGGCGGGCATCTCTTCAATTTTAGGGGCAATTAACTTTATTACAACAATTATTAATATGAAACCCCCTGCTATCTCTCAGTACCAAACCCCTTTGTTCGTGTGGGCCGTGCTAATTACTGCTGTTCTTCTACTCCTCTCACTTCCTGTTCTAGCTGCTGGTATTACTATACTTCTCACGGACCGAAATCTTAACACCACCTTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pagothenia borchgrevinki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bald notothen

Pagothenia borchgrevinki, the bald notothen, is a species of cod icefish native to the Southern Ocean where it is found in the Weddell Sea, the Ross Sea, the Davis Sea, in Vincennes Bay, and around the Budd Coast, the Antarctic Peninsula, South Orkneys and South Shetland Islands. It can be found at depths of from the surface to 550 metres (1,800 ft) though it is much rarer below 30 metres (98 ft). This species is often found along the under surfaces of ice foraging for prey such as sympagic copepods and krill. In turn, it is known to be preyed upon by the ploughfish, Gymnodraco acuticeps and the Antarctic toothfish, Dissostichus mawsoni. Antifreeze proteins in its blood prevent it freezing in the subzero water temperatures of Antarctica.[1]

Growing to a maximum length of about 28 cm (11 in) TL, it is yellow with dark spots and irregular crossbars. Its dorsal and caudal fins may occasionally also be spotted.[1]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2014). "Pagothenia borchgrevinki" in FishBase. February 2014 version.

,

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!