Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:359
Specimens with Sequences:351
Specimens with Barcodes:349
Species:5
Species With Barcodes:5
Public Records:303
Public Species:4
Public BINs:4
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Acrotomia muciaDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 123 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTTGGAACTTCCTTAAGATTATTAATTCGAGCAGAATTAGGGACTCCAGGATCTTTAATTGGAGACGATCAAATTTACAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGTTATGCCTATTATAATTGGAGGATTTGGTAATTGATTGGTACCCTTAATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTATCACACTTTTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACTGTTTACCCCCCTTTATCATCTAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCTATTTTTTCTCTGCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACTGCATTTTTATTATTACTATCATTACCAGTATTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acrotomia muciaDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 77
Specimens with Barcodes: 125
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acrotomia

Acrotomia is a genus of moth in the family Geometridae.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!