Overview
Comprehensive Description
Biology
Apparently restricted to areas with fast flowing waters, deep pools or rapids (Ref. 27732). Prefer habitats associated with rocky substrates (Ref. 37770). Occur in the mainstream of the Mekong River. Avoids tributaries and swamps (Ref. 7431). Reported to undertake short, local migrations (Ref. 37770). Active during twilight and night. Feed on fishes, crustaceans and insects. Also take smaller vertebrates (Ref. 58784). Spawning sites are found in inundated forests (Ref. 33813). Mature adults breed during the rainy season. Occasionally seen in the aquarium trade. (Ref. 12693). Has been bred for several years in Thailand (Ref. 7431).
-
Roberts, T.R. 1992 Systematic revision of the old world freshwater fish family Notopteridae. Ichthyol. Explor. Freshwat. 2(4):361-383. (Ref. 7431)
http://www.fishbase.org/references/FBRefSummary.php?id=7431&speccode=6086
Trusted
Distribution
Asia: mainstream of the Mekong in Thailand, Laos and Cambodia and the lower course of some tributaries.
-
Kottelat, M. 1998 Fishes of the Nam Theun and Xe Bangfai basins, Laos, with diagnoses of twenty-two new species (Teleostei: Cyprinidae, Balitoridae, Cobitidae, Coiidae and Odontobutidae). Ichthyol. Explor. Freshwat. 9(1):1-128. (Ref. 27732)
http://www.fishbase.org/references/FBRefSummary.php?id=27732&speccode=26858
Trusted
Physical Description
Size
Max. size
120 cm SL (male/unsexed; (Ref. 30857))
-
Baird, I.G., V. Inthaphaisy, P. Kisouvannalath, B. Phylavanh and B. Mounsouphom 1999 The fishes of southern Lao. Lao Community Fisheries and Dolphin Protection Project. Ministry of Agriculture and Forestry, Lao PDR.161 p. (Ref. 30857)
http://www.fishbase.org/references/FBRefSummary.php?id=30857&speccode=52537
Trusted
Diagnostic Description
Distinguishable by the presence of numerous small black spots (in the anterior half of the body), merging posteriorly into irregular oblique bands extending on the anal and caudal fins (Ref. 27732). Differs from all other species except C. lopis in having a large round black spot at base of pectoral fin. In C. blanci pectoral basal spot present in juveniles as small as 6 cm and retained throughout life (Ref. 7431).
-
Kottelat, M. 1998 Fishes of the Nam Theun and Xe Bangfai basins, Laos, with diagnoses of twenty-two new species (Teleostei: Cyprinidae, Balitoridae, Cobitidae, Coiidae and Odontobutidae). Ichthyol. Explor. Freshwat. 9(1):1-128. (Ref. 27732)
http://www.fishbase.org/references/FBRefSummary.php?id=27732&speccode=26858
Trusted
Ecology
Habitat
Habitat and Ecology
Habitat and Ecology
Systems
This species occurs in the Mekong mainstream and larger tributaries, especially in rocky rapid and submerged wood areas. Local people have reported spawning behaviour over rocky substrates, with parental care given to young.
Systems
- Freshwater
Trusted
Environment
demersal; potamodromous (Ref. 51243); freshwater
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Migration
Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Life History and Behavior
Life Cycle
Female guards the fry (to be verified).
-
Sokheng, C., C.K. Chhea, S. Viravong, K. Bouakhamvongsa, U. Suntornratana, N. Yoorong, N.T. Tung, T.Q. Bao, A.F. Poulsen and J.V. Jørgensen 1999 Fish migrations and spawning habits in the Mekong mainstream: a survey using local knowledge (basin-wide). Assessment of Mekong fisheries: Fish Migrations and Spawning and the Impact of Water Management Project (AMFC). AMFP Report 2/99. Vientiane, Lao, P.D.R. (Ref. 37770)
http://www.fishbase.org/references/FBRefSummary.php?id=37770&speccode=12102
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Chitala blanci
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC10068-09|NC_012710|Chitala blanci| ACCCGCTGACTATTCTCCACCAACCACAAAGATATCGGAACCCTATACCTTGTATTTGGGGCCTGAGCAGGCATAGTGGGCACAGCCCTA---AGCCTATTAATCCGAGCAGAGCTGAGCCAACCCGGCTCGTTACTTGGCGAC---GACCAGATCTATAATGTTATCGTTACAGCACACGCATTCGTAATAATCTTCTTCATAGTAATGCCTATTATAATTGGAGGCTTTGGAAACTGGCTAATCCCATTAATA---ATCGGGGCTCCAGATATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCATCATTCTTATTACTTCTAGCCTCTTCAGGAGTAGAAGCCGGCGCTGGAACTGGATGAACAGTATACCCGCCTTTAGCAGGAAATTTAGCACATGCAGGTGCCTCCGTAGACCTT---ACAATTTTTTCACTACATCTTGCTGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACAACAGTATTTAACATAAAACCTCCTGCCGTATCACAATATCAAACACCACTATTCATCTGAGCTGTTATAATTACTGCAGTTCTACTCTTACTATCACTTCCAGTTCTAGCTGCC---GGTATTACAATACTACTGACAGACCGAAACCTTAACACAACATTCTTCGACCCAGCAGGCGGAGGAGACCCGATTCTCTACCAACATCTATTCTGATTCTTTGGACATCCAGAAGTATACATTCTAATTCTCCCAGGTTTCGGTATAATTTCTCACATCGTAGCCTATTATTCTGGTAAAAAA---GAACCATTTGGCTATATAGGCATAGTTTGAGCTATAATGGCCATCGGACTGCTAGGCTTTATTGTATGAGCTCACCATATATTTACGGTAGGCATAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Chitala blanci
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1
Public Records: 2
Species: 2
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
NT
Near Threatened
Red List Criteria
Version
3.1
Year Assessed
2011
Assessor/s
Vidthayanon, C.
Reviewer/s
Rainboth, W. & Allen, D.
Contributor/s
Kottelat, M.
Justification
This species is endemic to the Mekong basin, where it is found in Lao PDR, Thailand, Viet Nam and Cambodia. It is restricted to rocky habitat and is susceptible to impacts from dam development.
It is assessed as Near Threatened on the basis of population declines and future habitat loss resulting from proposed dam development; several of the planned mainstream Mekong dams (e.g., the Ban Koum, Latseua and Pak Chom dams in Lao PDR and Thailand; the Sambor and Stung Treng dams in Cambodia) will impact upon populations of the species. However the scale of the impact and the timing of dam developments are not certain. A high proportion of the species population is likely to be impacted by dam construction as they are in the rocky habitat preferred by the species.
Further research is required, and it is possible that the species would qualify for a threatened category if all proposed dams are constructed within the species range.
It is assessed as Near Threatened on the basis of population declines and future habitat loss resulting from proposed dam development; several of the planned mainstream Mekong dams (e.g., the Ban Koum, Latseua and Pak Chom dams in Lao PDR and Thailand; the Sambor and Stung Treng dams in Cambodia) will impact upon populations of the species. However the scale of the impact and the timing of dam developments are not certain. A high proportion of the species population is likely to be impacted by dam construction as they are in the rocky habitat preferred by the species.
Further research is required, and it is possible that the species would qualify for a threatened category if all proposed dams are constructed within the species range.
History
- 1996Lower Risk/near threatened
- 1994Rare(Groombridge 1994)
- 1990Endangered(IUCN 1990)
- 1988Rare(IUCN Conservation Monitoring Centre 1988)
- 1986Rare(IUCN Conservation Monitoring Centre 1986)
Trusted
Trends
Population
Population
Population Trend
Locally common in northeastern Cambodia and southern Lao PDR. Much less common in Thai waters.
Population Trend
Unknown
Trusted
Threats
Threats
Major Threats
Habitat alteration, caused by dams and other infrastructure development, in the Mekong and larger tributaries. Dams in the Mekong mainstream pose future threats to critical habitats of this species. Overfishing for the aquarium trade and for consumption may lead to population declines in the near future.
Trusted
Lower Risk: near threatened (LR/nt)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Management
Conservation Actions
Conservation Actions
Habitat and fisheries management based on local participation is needed. Quota regulation of trade and export is recommended.
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; aquaculture: commercial; aquarium: commercial
-
Rainboth, W.J. 1996 Fishes of the Cambodian Mekong. FAO Species Identification Field Guide for Fishery Purposes. FAO, Rome, 265 p. (Ref. 12693)
http://www.fishbase.org/references/FBRefSummary.php?id=12693&speccode=26747
-
Roberts, T.R. 1992 Systematic revision of the old world freshwater fish family Notopteridae. Ichthyol. Explor. Freshwat. 2(4):361-383. (Ref. 7431)
http://www.fishbase.org/references/FBRefSummary.php?id=7431&speccode=6086
-
Vidthayanon, C. 2005 Thailand red data: fishes. Office of Natural Resources and Environmental Policy and Planning, Bangkok, Thailand. 108 p. (Ref. 58784)
http://www.fishbase.org/references/FBRefSummary.php?id=58784&speccode=6086
Trusted
Wikipedia
Royal Knifefish
The Royal Knifefish (Chitala blanci), also called Indochina Featherback, is a species of fish in the Notopteridae family. It is found in Cambodia and Thailand.
Source
- Kottelat, M. 1996. Chitala blanci. 2006 IUCN Red List of Threatened Species. Downloaded on 04 August 2007.
| This Osteoglossiformes-related article is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!




