Overview

Comprehensive Description

Biology

Apparently restricted to areas with fast flowing waters, deep pools or rapids (Ref. 27732). Prefer habitats associated with rocky substrates (Ref. 37770). Occur in the mainstream of the Mekong River. Avoids tributaries and swamps (Ref. 7431). Reported to undertake short, local migrations (Ref. 37770). Active during twilight and night. Feed on fishes, crustaceans and insects. Also take smaller vertebrates (Ref. 58784). Spawning sites are found in inundated forests (Ref. 33813). Mature adults breed during the rainy season. Occasionally seen in the aquarium trade. (Ref. 12693). Has been bred for several years in Thailand (Ref. 7431).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Asia: mainstream of the Mekong in Thailand, Laos and Cambodia and the lower course of some tributaries.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm SL (male/unsexed; (Ref. 30857))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguishable by the presence of numerous small black spots (in the anterior half of the body), merging posteriorly into irregular oblique bands extending on the anal and caudal fins (Ref. 27732). Differs from all other species except C. lopis in having a large round black spot at base of pectoral fin. In C. blanci pectoral basal spot present in juveniles as small as 6 cm and retained throughout life (Ref. 7431).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in the Mekong mainstream and larger tributaries, especially in rocky rapid and submerged wood areas. Local people have reported spawning behaviour over rocky substrates, with parental care given to young.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Female guards the fry (to be verified).
  • Sokheng, C., C.K. Chhea, S. Viravong, K. Bouakhamvongsa, U. Suntornratana, N. Yoorong, N.T. Tung, T.Q. Bao, A.F. Poulsen and J.V. Jørgensen 1999 Fish migrations and spawning habits in the Mekong mainstream: a survey using local knowledge (basin-wide). Assessment of Mekong fisheries: Fish Migrations and Spawning and the Impact of Water Management Project (AMFC). AMFP Report 2/99. Vientiane, Lao, P.D.R. (Ref. 37770)   http://www.fishbase.org/references/FBRefSummary.php?id=37770&speccode=12102 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chitala blanci

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC10068-09|NC_012710|Chitala blanci| ACCCGCTGACTATTCTCCACCAACCACAAAGATATCGGAACCCTATACCTTGTATTTGGGGCCTGAGCAGGCATAGTGGGCACAGCCCTA---AGCCTATTAATCCGAGCAGAGCTGAGCCAACCCGGCTCGTTACTTGGCGAC---GACCAGATCTATAATGTTATCGTTACAGCACACGCATTCGTAATAATCTTCTTCATAGTAATGCCTATTATAATTGGAGGCTTTGGAAACTGGCTAATCCCATTAATA---ATCGGGGCTCCAGATATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCATCATTCTTATTACTTCTAGCCTCTTCAGGAGTAGAAGCCGGCGCTGGAACTGGATGAACAGTATACCCGCCTTTAGCAGGAAATTTAGCACATGCAGGTGCCTCCGTAGACCTT---ACAATTTTTTCACTACATCTTGCTGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACAACAGTATTTAACATAAAACCTCCTGCCGTATCACAATATCAAACACCACTATTCATCTGAGCTGTTATAATTACTGCAGTTCTACTCTTACTATCACTTCCAGTTCTAGCTGCC---GGTATTACAATACTACTGACAGACCGAAACCTTAACACAACATTCTTCGACCCAGCAGGCGGAGGAGACCCGATTCTCTACCAACATCTATTCTGATTCTTTGGACATCCAGAAGTATACATTCTAATTCTCCCAGGTTTCGGTATAATTTCTCACATCGTAGCCTATTATTCTGGTAAAAAA---GAACCATTTGGCTATATAGGCATAGTTTGAGCTATAATGGCCATCGGACTGCTAGGCTTTATTGTATGAGCTCACCATATATTTACGGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chitala blanci

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Vidthayanon, C.

Reviewer/s
Rainboth, W. & Allen, D.

Contributor/s
Kottelat, M.

Justification
This species is endemic to the Mekong basin, where it is found in Lao PDR, Thailand, Viet Nam and Cambodia. It is restricted to rocky habitat and is susceptible to impacts from dam development.

It is assessed as Near Threatened on the basis of population declines and future habitat loss resulting from proposed dam development; several of the planned mainstream Mekong dams (e.g., the Ban Koum, Latseua and Pak Chom dams in Lao PDR and Thailand; the Sambor and Stung Treng dams in Cambodia) will impact upon populations of the species. However the scale of the impact and the timing of dam developments are not certain. A high proportion of the species population is likely to be impacted by dam construction as they are in the rocky habitat preferred by the species.

Further research is required, and it is possible that the species would qualify for a threatened category if all proposed dams are constructed within the species range.

History
  • 1996
    Lower Risk/near threatened
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Locally common in northeastern Cambodia and southern Lao PDR. Much less common in Thai waters.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Habitat alteration, caused by dams and other infrastructure development, in the Mekong and larger tributaries. Dams in the Mekong mainstream pose future threats to critical habitats of this species. Overfishing for the aquarium trade and for consumption may lead to population declines in the near future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lower Risk: near threatened (LR/nt)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Habitat and fisheries management based on local participation is needed. Quota regulation of trade and export is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Royal Knifefish

The Royal Knifefish (Chitala blanci), also called Indochina Featherback, is a species of fish in the Notopteridae family. It is found in Cambodia and Thailand.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!