Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on muddy substrates, from well-protected shallow estuaries to quiet, deep offshore reefs (Ref. 9710, 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Persian Gulf and East Africa to New Guinea, south to Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Persian Gulf, Madagascar and Mauritius (Mascarenes) east to Philippines, south to Western Australia and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 300 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm SL (male/unsexed; (Ref. 30573))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species is distinguished by having no spots on the median fins and generally, its shorter dorsal spines (Ref. 74961).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 15 - 60 m (Ref. 74961), usually 20 - ? m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 145 specimens in 1 taxon.
Water temperature and chemistry ranges based on 74 samples.

Environmental ranges
  Depth range (m): 8.9 - 165
  Temperature range (°C): 20.374 - 28.199
  Nitrate (umol/L): 0.164 - 10.882
  Salinity (PPS): 34.438 - 35.468
  Oxygen (ml/l): 2.138 - 4.701
  Phosphate (umol/l): 0.083 - 1.043
  Silicate (umol/l): 0.777 - 17.115

Graphical representation

Depth range (m): 8.9 - 165

Temperature range (°C): 20.374 - 28.199

Nitrate (umol/L): 0.164 - 10.882

Salinity (PPS): 34.438 - 35.468

Oxygen (ml/l): 2.138 - 4.701

Phosphate (umol/l): 0.083 - 1.043

Silicate (umol/l): 0.777 - 17.115
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: reef-associated. Inhabits offshore reefs (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154). Inhabits offshore reefs (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois russelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGCATAGTAGGCACAGCCTTGAGCCTGCTTATTCGAGCAGAACTTAGCCAACCGGGCGCTCTATTGGGAGACGACCAAATCTATAATGTAATTGTTACAGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGTTTTGGAAACTGGCTTATCCCGCTGATGATTGGGGCACCAGACATAGCATTTCCTCGTATAAATAACATGAGTTTCTGGCTTCTCCCCCCTTCCTTCCTCCTTCTCCTGGCCTCTTCAGGAGTTGAGGCAGGGGCTGGAACAGGATGAACTGTTTACCCTCCCTTAGCGGGCAATCTTGCCCATGCCGGGGCATCTGTAGACCTAACAATTTTCTCCTTGCACTTAGCAGGCATTTCATCAATCCTGGGGGCAATCAATTTTATTACAACAATTATTAATATAAAACCCCCAGCTATTTCCCAGTACCAAACTCCACTGTTTGTATGAGCTGTCTTAATTACGGCAGTTCTTTTACTTCTTTCGCTCCCAGTCCTTGCCGCCGGTATTACAATACTGCTTACTGATCGAAACCTCAACACCACCTTCTTTGACCCAGCGGGGGGAGGAGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois russelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pterois russelli

Pterois russelli, the plaintail turkeyfish or Russell's lionfish is a lionfish species native to the Indo-Pacific ocean from the eastern part of Africa to the Persian Gulf. They grow up to 30 cm in length. It occasionally makes its way into the aquarium trade.

Care[edit]

This lionfish needs a minimum of a 50-gallon aquarium with many hiding places. Two lionfish should not be put in the same tank, as they will fight. Keep the water temperature at anywhere from 72–78°F (22-25.5º C). When performing maintenance, be sure to keep hands away from it, as they have a venomous sting, which isn't a real threat unless one is allergic. The pH-value should be between 8.1 and 8.4, and the specific gravity at 1.022–1.025. They will most likely eat live fish and shrimp; it will take time for them to eat frozen foods. [1]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!