Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on muddy substrates, from well-protected shallow estuaries to quiet, deep offshore reefs (Ref. 9710, 48635). Also found in bays and coastal waters, solitary (Ref 90102).
  • Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Persian Gulf and East Africa to New Guinea, south to Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Persian Gulf, Madagascar and Mauritius (Mascarenes) east to Philippines, south to Western Australia and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 7 - 8
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm SL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species is distinguished by having no spots on the median fins and generally, its shorter dorsal spines (Ref. 74961). Description: Characterized by having head and body with numerous reddish-brown bars of variable width, separated by narrow white bars; generally brownish pectoral fins without prominent dark bands; dorsal spines free of membrane except basally; enlarged and wing-like pectoral fins with rays free of membrane distally, unbranched rays; depth of body 2.7-3.2 in SL (Ref 90102).
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 15 - 60 m (Ref. 74961), usually 20 - ? m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 145 specimens in 1 taxon.
Water temperature and chemistry ranges based on 74 samples.

Environmental ranges
  Depth range (m): 8.9 - 165
  Temperature range (°C): 20.374 - 28.199
  Nitrate (umol/L): 0.164 - 10.882
  Salinity (PPS): 34.438 - 35.468
  Oxygen (ml/l): 2.138 - 4.701
  Phosphate (umol/l): 0.083 - 1.043
  Silicate (umol/l): 0.777 - 17.115

Graphical representation

Depth range (m): 8.9 - 165

Temperature range (°C): 20.374 - 28.199

Nitrate (umol/L): 0.164 - 10.882

Salinity (PPS): 34.438 - 35.468

Oxygen (ml/l): 2.138 - 4.701

Phosphate (umol/l): 0.083 - 1.043

Silicate (umol/l): 0.777 - 17.115
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: reef-associated. Inhabits offshore reefs (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154). Inhabits offshore reefs (Ref. 9710).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois russelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGCATAGTAGGCACAGCCTTGAGCCTGCTTATTCGAGCAGAACTTAGCCAACCGGGCGCTCTATTGGGAGACGACCAAATCTATAATGTAATTGTTACAGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGTTTTGGAAACTGGCTTATCCCGCTGATGATTGGGGCACCAGACATAGCATTTCCTCGTATAAATAACATGAGTTTCTGGCTTCTCCCCCCTTCCTTCCTCCTTCTCCTGGCCTCTTCAGGAGTTGAGGCAGGGGCTGGAACAGGATGAACTGTTTACCCTCCCTTAGCGGGCAATCTTGCCCATGCCGGGGCATCTGTAGACCTAACAATTTTCTCCTTGCACTTAGCAGGCATTTCATCAATCCTGGGGGCAATCAATTTTATTACAACAATTATTAATATAAAACCCCCAGCTATTTCCCAGTACCAAACTCCACTGTTTGTATGAGCTGTCTTAATTACGGCAGTTCTTTTACTTCTTTCGCTCCCAGTCCTTGCCGCCGGTATTACAATACTGCTTACTGATCGAAACCTCAACACCACCTTCTTTGACCCAGCGGGGGGAGGAGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois russelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
  • Blaber, S.J.M., D.T. Brewer and A.N. Harris 1994 Distribution, biomass and community structure of demersal fishes of the Gulf of Carpentaria, Australia. Aust. J. Mar. Freshwat. Res. 45(3):375-396. (Ref. 9700)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Soldier lionfish

The soldier lionfish, plaintail turkeyfish, or Russell's lionfish, Pterois russelli, is a lionfish species native to the Indo-Pacific Ocean from the eastern part of Africa to the Persian Gulf. They grow up to 30 cm in length.[2] It occasionally makes its way into the aquarium trade.

References[edit]

  1. ^ Allen, Gerald R.; Erdmann, Mark V. (23 January 2008). "Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea". aqua, International Journal of Ichthyology. Special Publication 13 (3-4): 137. Retrieved 13 October 2014. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Pterois russelli" in FishBase. December 2008 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!