Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on muddy substrates, from well-protected shallow estuaries to quiet, deep offshore reefs (Ref. 9710, 48635). Also found in bays and coastal waters, solitary (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Persian Gulf and East Africa to New Guinea, south to Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Persian Gulf, Madagascar and Mauritius (Mascarenes) east to Philippines, south to Western Australia and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm SL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This species is distinguished by having no spots on the median fins and generally, its shorter dorsal spines (Ref. 74961). Description: Characterized by having head and body with numerous reddish-brown bars of variable width, separated by narrow white bars; generally brownish pectoral fins without prominent dark bands; dorsal spines free of membrane except basally; enlarged and wing-like pectoral fins with rays free of membrane distally, unbranched rays; depth of body 2.7-3.2 in SL (Ref 90102).
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 15 - 60 m (Ref. 74961), usually 20 - ? m (Ref. 9710)
  • Allen, G.R. and M.V. Erdmann 2008 Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea. Aqua Int. J. Ichthyol. 13(3-4):127-138. (Ref. 74961)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 145 specimens in 1 taxon.
Water temperature and chemistry ranges based on 74 samples.

Environmental ranges
  Depth range (m): 8.9 - 165
  Temperature range (°C): 20.374 - 28.199
  Nitrate (umol/L): 0.164 - 10.882
  Salinity (PPS): 34.438 - 35.468
  Oxygen (ml/l): 2.138 - 4.701
  Phosphate (umol/l): 0.083 - 1.043
  Silicate (umol/l): 0.777 - 17.115

Graphical representation

Depth range (m): 8.9 - 165

Temperature range (°C): 20.374 - 28.199

Nitrate (umol/L): 0.164 - 10.882

Salinity (PPS): 34.438 - 35.468

Oxygen (ml/l): 2.138 - 4.701

Phosphate (umol/l): 0.083 - 1.043

Silicate (umol/l): 0.777 - 17.115
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: reef-associated. Inhabits offshore reefs (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154). Inhabits offshore reefs (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois russelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGCATAGTAGGCACAGCCTTGAGCCTGCTTATTCGAGCAGAACTTAGCCAACCGGGCGCTCTATTGGGAGACGACCAAATCTATAATGTAATTGTTACAGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGTTTTGGAAACTGGCTTATCCCGCTGATGATTGGGGCACCAGACATAGCATTTCCTCGTATAAATAACATGAGTTTCTGGCTTCTCCCCCCTTCCTTCCTCCTTCTCCTGGCCTCTTCAGGAGTTGAGGCAGGGGCTGGAACAGGATGAACTGTTTACCCTCCCTTAGCGGGCAATCTTGCCCATGCCGGGGCATCTGTAGACCTAACAATTTTCTCCTTGCACTTAGCAGGCATTTCATCAATCCTGGGGGCAATCAATTTTATTACAACAATTATTAATATAAAACCCCCAGCTATTTCCCAGTACCAAACTCCACTGTTTGTATGAGCTGTCTTAATTACGGCAGTTCTTTTACTTCTTTCGCTCCCAGTCCTTGCCGCCGGTATTACAATACTGCTTACTGATCGAAACCTCAACACCACCTTCTTTGACCCAGCGGGGGGAGGAGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois russelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Soldier lionfish

The soldier lionfish, plaintail turkeyfish, or Russell's lionfish, Pterois russelli, is a lionfish species native to the Indo-Pacific Ocean from the eastern part of Africa to the Persian Gulf. They grow up to 30 cm in length.[2] It occasionally makes its way into the aquarium trade.

References[edit]

  1. ^ Allen, Gerald R.; Erdmann, Mark V. (23 January 2008). "Pterois andover, a new species of scorpionfish (Pisces: Scorpaenidae) from Indonesia and Papua New Guinea". aqua, International Journal of Ichthyology. Special Publication 13 (3-4): 137. Retrieved 13 October 2014. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Pterois russelli" in FishBase. December 2008 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!