Overview

Comprehensive Description

Biology

Usually found in small groups in rocky reefs with little coral cover (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in the western Indian Ocean, in South Africa (Natal), Madagascar, Reunion, Mauritius, Rodrigues and the Seychelles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: Mauritius and Natal, South Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: KwaZulu-Natal (South Africa), Madagascar, Seychelles; Réunion, Mauritius and Rodrigues (Mascarenes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in small groups in rocky reef areas with little coral cover (Lieske and Myers 1994), at depths of 4-25 m (Baensch and Debelius 1997).

There appears to be some colour dimorphism between the initial phase (with a whitish belly) and the terminal phase (with a greenish body, darker above, and yellow bands behind the head and before the tail). It feeds on benthic macro-invertebrates (Masuda and Allen 1993).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - ? m (Ref. 58018), usually 4 - 25 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 6 - 7

Graphical representation

Depth range (m): 6 - 7
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Usually found in small groups in rocky reefs with little coral cover (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassoma genivittatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Thalassoma genivittatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CATAAAGATATTGGCACCCTCTATCTTGTATTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGAGCAGAGTTAAGCCAGCCCGGCGCCCTCCTTGGGGAC---GATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAATATAAGCTTTTGACTTCTTCCCCCCTCATTCCTGCTTCTTCTTGCCTCTTCTGGTGTTGAGGCGGGGGCCGGAACCGGATGGACAGTCTACCCGCCCTTAGCAGGTAACCTTGCCCACGCTGGTGCATCCGTTGACCTAACTATCTTCTCACTACATCTGGCAGGTATTTCATCAATTCTAGGTGCAATTAATTTCATTACAACCATTATTAATATGAAACCCCCAGCCATCTCTCAATACCAAACACCCCTCTTCGTATGGGCCGTTCTAATTACAGCAGTCCTTCTCCTCCTTTCCCTTCCAGTACTTGCTGCCGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACTACCTTCTTCGACCCTGCCGGGGGAGGAGACCCAATTCTTTACCAACATCTCTTCTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D. & Cabanban, A.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species has a relatively restricted range in the Indian Ocean, and is considered common in at least parts of its range. It is collected for the aquarium trade, but there are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in the Seychelles (L. Rocha pers. comm. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is occasionally collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma genivittatum

The red-cheek wrasse, Thalassoma genivittatum, is a species of wrasse native to the western Indian Ocean, where it can be found on rocky reefs at depths from 4 to 25 m (13 to 82 ft). It can grow to 20 cm (7.9 in) in total length. This species can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Pollard, D. & Cabanban, A. 2010. Thalassoma genivittatum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma genivittatum" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!