Overview

Distribution

Western Indian Ocean: Mauritius.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Indian Ocean: Comores, Madagascar, Réunion and Mauritius (western Mascarenes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 120 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 5503))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 30 - 30
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Seen in video images swimming upside down in front of a cave in 260 m (Ref. 58472) .
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhitichthys guichenoti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGAGCTGGGATAGTCGGAACAGCTCTTAGCCTACTTATTCGGGCAGAACTCAGTCAACCCGGGGCCCTCCTCGGAGATGACCAGATTTACAACGTAATCGTTACGGCACACGCCTTTGTAATGATTTTCTTCATAGTTATACCAATTATGATCGGGGGCTTTGGCAACTGACTTATCCCCCTAATGATTGGGGCCCCAGACATGGCATTCCCGCGAATGAACAACATGAGCTTTTGACTTCTTCCCCCCTCTTTCCTGCTGCTCCTAGCCTCCTCTGGCGTAGAAGCCGGCGCGGGGACGGGTTGAACAGTATATCCCCCCCTCGCAGGCAACTTGGCACATGCAGGAGCATCTGTAGATTTAACTATTTTCTCTCTTCATCTTGCCGGAATCTCTTCAATCCTAGGGGCTATCAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATCTCTCAGTACCAAACCCCCCTCTTTGTCTGAGCGGTCCTAATCACAGCGGTTCTTCTTCTCCTTTCCCTCCCAGTGCTTGCCGCGGGGATTACAATGCTCTTAACAGACCGAAACTTAAACACAACCTTTTTTGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhitichthys guichenoti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!