Overview

Comprehensive Description

Biology

Found on silty bottoms of coastal reefs and inner reef flats (Ref. 9710). Inhabits coastal waters, including mangroves, large tidal pools or inner reef lagoons, on sand and rubble substrates (Ref. 48637). Also found in sheltered sand and mud bottoms to 10 m (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Singapore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Indonesia to New Caledonia, north to the Yaeyama Islands, south to northwestern Australia. Recently recorded from Tonga (Ref. 53797).
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 10 - 11; Analspines: 1; Analsoft rays: 10 - 11
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm SL (male/unsexed; (Ref. 48637))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by pale brownish green body color grading to whitish ventrally; 6-7 diffuse brownish bars on side; head, back and dorsal fins with pale-edged pink to red spots and smaller white spots; blue-edged orange to brown spots on first dorsal fin; united pelvic fins, presence of frenum; longitudinal scale series 77-92; head without scales; greatest depth of body 5.4-6.0 in SL; rounded caudal fin, longer than head length (Ref 90102).
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 10 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.2 - 3
  Temperature range (°C): 24.198 - 26.890
  Nitrate (umol/L): 0.090 - 0.430
  Salinity (PPS): 32.183 - 35.310
  Oxygen (ml/l): 4.636 - 4.847
  Phosphate (umol/l): 0.131 - 0.246
  Silicate (umol/l): 1.005 - 14.847

Graphical representation

Depth range (m): 0.2 - 3

Temperature range (°C): 24.198 - 26.890

Nitrate (umol/L): 0.090 - 0.430

Salinity (PPS): 32.183 - 35.310

Oxygen (ml/l): 4.636 - 4.847

Phosphate (umol/l): 0.131 - 0.246

Silicate (umol/l): 1.005 - 14.847
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits silty bottoms of inner reef flats and coastal reefs.
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cryptocentrus leptocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTCTTTGGTGCNTGAGCCGGAATAGTAGGCACAGCATTGAGCCTACTTATTCGAGCTGAGCTAAGCCAGCCCGGCGCCCTCTTAGGGGACGATCAAATTTATAACGTGATCGTTACCGCCCACGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGAAACTGACTTATCCCCCTAATAATCGGGGCCCCCGACATAGCCTTCCCCCGAATGAATAACATAAGCTTCTGACTACTTCCCCCTTCCTTCCTACTTCTCCTGGCATCTTCCGGCGTAGAAGCCGGGGCAGGGACCGGATGAACAGTCTACCCCCCTCTAGCAGGCAACTTAGCACATGCAGGAGCATCAGTTGATCTAACAATTTTCTCCCTCCACTTAGCAGGGATCTCTTCAATCCTGGGGGCCATTAATTTTATTACAACAATCCTAAATATGAAGCCTCCAGCCATCTCACAGTATCAAACACCACTCTTTGTATGAGCAGTTTTAATTACCGCTGTATTACTTCTTCTTTCTCTGCCCGTACTTGCCGCTGGCATCACAATGCTTCTTACAGATCGAAATCTAAACACAACATTCTTCGACCCTGCCGGTGGAGGAGACCCCATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cryptocentrus leptocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pink-speckled shrimpgoby

Cryptocentrus leptocephalus, the Pink-speckled shrimpgoby, is a species of goby native to the western Pacific Ocean where it occurs on silty substrates in coastal reefs, lagoons, mangrove swamps and tide pools. It grows to a length of 12 centimetres (4.7 in) SL.[1]

References[edit source | edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cryptocentrus leptocephalus" in FishBase. June 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!