Overview

Comprehensive Description

Biology

Found on silty bottoms of coastal reefs and inner reef flats (Ref. 9710). Inhabits coastal waters, including mangroves, large tidal pools or inner reef lagoons, on sand and rubble substrates (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Singapore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: Indonesia to New Caledonia, north to the Yaeyama Islands, south to northwestern Australia. Recently recorded from Tonga (Ref. 53797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 10 - 11; Analspines: 1; Analsoft rays: 10 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0.2 - 3
  Temperature range (°C): 24.198 - 26.890
  Nitrate (umol/L): 0.090 - 0.430
  Salinity (PPS): 32.183 - 35.310
  Oxygen (ml/l): 4.636 - 4.847
  Phosphate (umol/l): 0.131 - 0.246
  Silicate (umol/l): 1.005 - 14.847

Graphical representation

Depth range (m): 0.2 - 3

Temperature range (°C): 24.198 - 26.890

Nitrate (umol/L): 0.090 - 0.430

Salinity (PPS): 32.183 - 35.310

Oxygen (ml/l): 4.636 - 4.847

Phosphate (umol/l): 0.131 - 0.246

Silicate (umol/l): 1.005 - 14.847
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits silty bottoms of inner reef flats and coastal reefs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cryptocentrus leptocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTCTTTGGTGCNTGAGCCGGAATAGTAGGCACAGCATTGAGCCTACTTATTCGAGCTGAGCTAAGCCAGCCCGGCGCCCTCTTAGGGGACGATCAAATTTATAACGTGATCGTTACCGCCCACGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGAAACTGACTTATCCCCCTAATAATCGGGGCCCCCGACATAGCCTTCCCCCGAATGAATAACATAAGCTTCTGACTACTTCCCCCTTCCTTCCTACTTCTCCTGGCATCTTCCGGCGTAGAAGCCGGGGCAGGGACCGGATGAACAGTCTACCCCCCTCTAGCAGGCAACTTAGCACATGCAGGAGCATCAGTTGATCTAACAATTTTCTCCCTCCACTTAGCAGGGATCTCTTCAATCCTGGGGGCCATTAATTTTATTACAACAATCCTAAATATGAAGCCTCCAGCCATCTCACAGTATCAAACACCACTCTTTGTATGAGCAGTTTTAATTACCGCTGTATTACTTCTTCTTTCTCTGCCCGTACTTGCCGCTGGCATCACAATGCTTCTTACAGATCGAAATCTAAACACAACATTCTTCGACCCTGCCGGTGGAGGAGACCCCATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cryptocentrus leptocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pink-speckled shrimpgoby

Pink-speckled shrimpgoby (also called Pinkspotted Shrimp Goby), Cryptocentrus leptocephalus, is a goby from the Western Pacific: Indonesia to New Caledonia, north to the Yaeyama Islands, south to northwestern Australia, also Tonga. It grows to a size of 12 cm in length. It occasionally makes its way into the aquarium trade.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!