Overview
Comprehensive Description
Biology
Found on silty bottoms of coastal reefs and inner reef flats (Ref. 9710). Inhabits coastal waters, including mangroves, large tidal pools or inner reef lagoons, on sand and rubble substrates (Ref. 48637).
-
Russell, B.C., T.H. Fraser and H.K. Larson 2010 Castelnauâs collection of Singapore fishes described by Pieter Bleeker. Raffles Bull. Zool. 58(1):93-102. (Ref. 84167)
http://www.fishbase.org/references/FBRefSummary.php?id=84167&speccode=25799
Trusted
Distribution
Western Pacific: Indonesia to New Caledonia, north to the Yaeyama Islands, south to northwestern Australia. Recently recorded from Tonga (Ref. 53797).
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Physical Description
Morphology
Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 10 - 11; Analspines: 1; Analsoft rays: 10 - 11
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Size
Max. size
12.0 cm SL (male/unsexed; (Ref. 48637))
-
Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
http://www.fishbase.org/references/FBRefSummary.php?id=48637&speccode=4748
Trusted
Ecology
Habitat
Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 0.2 - 3
Temperature range (°C): 24.198 - 26.890
Nitrate (umol/L): 0.090 - 0.430
Salinity (PPS): 32.183 - 35.310
Oxygen (ml/l): 4.636 - 4.847
Phosphate (umol/l): 0.131 - 0.246
Silicate (umol/l): 1.005 - 14.847
Graphical representation
Depth range (m): 0.2 - 3
Temperature range (°C): 24.198 - 26.890
Nitrate (umol/L): 0.090 - 0.430
Salinity (PPS): 32.183 - 35.310
Oxygen (ml/l): 4.636 - 4.847
Phosphate (umol/l): 0.131 - 0.246
Silicate (umol/l): 1.005 - 14.847
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 0.2 - 3
Temperature range (°C): 24.198 - 26.890
Nitrate (umol/L): 0.090 - 0.430
Salinity (PPS): 32.183 - 35.310
Oxygen (ml/l): 4.636 - 4.847
Phosphate (umol/l): 0.131 - 0.246
Silicate (umol/l): 1.005 - 14.847
Graphical representation
Depth range (m): 0.2 - 3
Temperature range (°C): 24.198 - 26.890
Nitrate (umol/L): 0.090 - 0.430
Salinity (PPS): 32.183 - 35.310
Oxygen (ml/l): 4.636 - 4.847
Phosphate (umol/l): 0.131 - 0.246
Silicate (umol/l): 1.005 - 14.847
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Inhabits silty bottoms of inner reef flats and coastal reefs.
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Cryptocentrus leptocephalus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTACTTAGTCTTTGGTGCNTGAGCCGGAATAGTAGGCACAGCATTGAGCCTACTTATTCGAGCTGAGCTAAGCCAGCCCGGCGCCCTCTTAGGGGACGATCAAATTTATAACGTGATCGTTACCGCCCACGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGAAACTGACTTATCCCCCTAATAATCGGGGCCCCCGACATAGCCTTCCCCCGAATGAATAACATAAGCTTCTGACTACTTCCCCCTTCCTTCCTACTTCTCCTGGCATCTTCCGGCGTAGAAGCCGGGGCAGGGACCGGATGAACAGTCTACCCCCCTCTAGCAGGCAACTTAGCACATGCAGGAGCATCAGTTGATCTAACAATTTTCTCCCTCCACTTAGCAGGGATCTCTTCAATCCTGGGGGCCATTAATTTTATTACAACAATCCTAAATATGAAGCCTCCAGCCATCTCACAGTATCAAACACCACTCTTTGTATGAGCAGTTTTAATTACCGCTGTATTACTTCTTCTTTCTCTGCCCGTACTTGCCGCTGGCATCACAATGCTTCTTACAGATCGAAATCTAAACACAACATTCTTCGACCCTGCCGGTGGAGGAGACCCCATTCTTTACCAACACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Cryptocentrus leptocephalus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Wikipedia
Pink-speckled shrimpgoby
Pink-speckled shrimpgoby (also called Pinkspotted Shrimp Goby), Cryptocentrus leptocephalus, is a goby from the Western Pacific: Indonesia to New Caledonia, north to the Yaeyama Islands, south to northwestern Australia, also Tonga. It grows to a size of 12 cm in length. It occasionally makes its way into the aquarium trade.
References
| This Gobiidae-related article is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



