Overview

Comprehensive Description

Biology

Found on coral rubble (Ref. 43239). Collected from river mouths (Ref. 559). Feeds on zooplankton (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea to the Society Islands north to Yaeyama Islands, south to New Guinea; Marshall Islands in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 10; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 25 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 25 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

3.0 cm SL (male/unsexed; (Ref. 43239))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from A. semipunctata by having a single spine on the preopercular margin (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 6 - 40 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 43 specimens in 1 taxon.
Water temperature and chemistry ranges based on 20 samples.

Environmental ranges
  Depth range (m): 0.915 - 40
  Temperature range (°C): 24.633 - 29.205
  Nitrate (umol/L): 0.052 - 0.834
  Salinity (PPS): 32.613 - 36.142
  Oxygen (ml/l): 4.130 - 4.851
  Phosphate (umol/l): 0.070 - 0.359
  Silicate (umol/l): 0.506 - 5.009

Graphical representation

Depth range (m): 0.915 - 40

Temperature range (°C): 24.633 - 29.205

Nitrate (umol/L): 0.052 - 0.834

Salinity (PPS): 32.613 - 36.142

Oxygen (ml/l): 4.130 - 4.851

Phosphate (umol/l): 0.070 - 0.359

Silicate (umol/l): 0.506 - 5.009
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits bare rubble slopes exposed to currents and hovers above the bottom to feed on zooplankton (Ref. 37816). Found on coral rubble (Ref. 43239). Collected from river mouths (Ref. 559). Feeds on zooplankton (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asterropteryx ensifera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTCGTGTTTGGTGCCTGAGCCGGAATAGTGGGAACAGCCTTAAGCCTGCTGATTCGGGCCGAACTTAGTCAGCCTGGGGCCCTCCTAGGAGACGACCAAATCTACAATGTCATTGTAACCGCCCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTTATCCCCCTAATGATTGGAGCCCCCGATATAGCATTCCCCCGAATAAATAACATGAGCTTCTGACTACTGCCCCCTTCTTTCCTTCTACTACTCGCCTCCTCCGGGGTTGAAGCCGGGGCCGGAACAGGGTGAACGGTGTACCCCCCACTTGCAGGAAATCTTGCCCACGCAGGGGCCTCCGTTGACCTAACCATTTTCTCCCTCCACCTGGCCGGTATTTCCTCGATCCTTGGAGCAATCAACTTCATCACTACAATCCTTAACATGAAACCCCCAGCTATCTCACAATACCAAACACCCCTATTCGTTTGAGCCGTGTTAATTACTGCCGTACTACTTCTTCTCTCACTACCTGTTCTTGCAGCAGGAATTACAATGCTTCTTACGGACCGAAACCTAAACACCACCTTCTTCGACCCGGCAGGAGGAGGGGACCCCATTCTATACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Asterropteryx ensifera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Asterropteryx ensifera

Asterropteryx ensifera, known commonly as the Miller's Damsel , is a species of marine fish in the family Gobiidae.

It is widespread throughout the tropical waters of the Indo-Pacific area; the Red Sea included.[1]

This is a small size fish that can reach a maximum size of 3 cm length.[2]

References[edit]

  1. ^ "Facts about Miller's Damsel (Asterropteryx ensifera) - Encyclopedia of Life". Eol.org. 2013-04-25. Retrieved 2013-09-03. 
  2. ^ "Asterropteryx ensifera, Miller's damsel". Fishbase.org. 2012-07-03. Retrieved 2013-09-03. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!