Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Eels are mysterious fish. For the longest time, it was unknown as to where they spawned. Juvenile eels look very different than adults so that people also used to think that they were two different species of fish. Eel can live in fresh as well as salt water. As long as the ground is wet enough, they can move on land. Eels are momentarily threatened by overfishing. Obstacles between fresh and salt water also form a problem. In 2007, the eel was declared as a protected animal species. A European recovery plan has been developed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The common eel has a fascinating life-cycle; it is a 'catadromous' species, breeding in the sea and migrating to freshwater in order to grow before returning to the sea to spawn (4). It is thought that all European eels spawn in the Sargasso Sea. The larvae, which look like curled leaves and are known as 'leptocephalli', drift in the plankton for up to three years (2), and are carried by the Gulf Stream towards the coasts of Europe (3). They then undergo metamorphosis into young eels; at this stage they are known as 'glass eels' because they are transparent (2). They become darker in colour and start to migrate up freshwater streams in large numbers; they are known as 'elvers' at this time and measure around 50 mm in length (2). The eels, now called 'brown' or 'yellow eels' grow in freshwater (5), with males and females spending 6 to 12 and 9 to 20 years in freshwater, respectively (3). Towards the end of this time, they become sexually mature; they turn a silvery colour and migrate back towards the sea on dark, moonless and stormy nights; during this time they are known as 'silver eels' (5). Upon returning to the sea, the common eel lives in mud, crevices, and under stones (3). Spawning occurs during winter and early spring in the Sargasso Sea (3). This is a very long-lived species with a maximum life span of 85 years (3). This eel is predated upon by birds, including cormorants and gulls, as well as a number of species of fish (3). Remarkably, they can survive out of water for several hours on damp nights; they may travel overland on dark rainy nights (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common or European eel has a very unusual and fascinating life cycle. Adults have long, narrow bodies, with a continuous dorsal, anal and tail-fin (2). The skin is slimy, the lower jaw is longer than the upper jaw, and the scales are tiny or absent (2). The colour of adults depends on their age; they are often brown, black or olive-green with yellowish bellies. Some adults may be silvery (known as 'silver eels'); the lifecycle stages differ greatly in appearance (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits all types of benthic habitats from streams to shores of large rivers and lakes. Naturally found only in water bodies connected to the sea (Ref. 59043). Territorial and solitary species; 'schools' of young eels which are observed from time to time are a mass response to outward conditions and not of active assembling (Ref. 172). Amphihaline (Ref. 51442). Migrates to the depths of the Sargasso Sea to spawn (Ref. 172, 51442). Eel larvae (leptocephali) are transparent ribbon-like. They are brought to the coasts of Europe by the Gulf Stream in 7 to 11 months time (Ref. 51442) and can last for up to 3 years (Ref. 8994). They are transformed into glass eels (6-8 cm length, cylindrical in shape and transparent to slightly pigmented in colour). They enter the estuaries and colonize rivers and lakes (Ref. 11941, 51442); some individuals remain in estuaries and coastal waters to grow into adults (Ref. 88171). The glass eel stage is followed by a long feeding period (from the yellow to the silver eel stage) lasting 6-12 years in males (Ref. 6125) and 9-20 years in females (Ref. 6125). Yellow and silver eels are benthic, found under stones, buried in the mud or in crevices (Ref. 89138). Yellow eels eventually lose their pigmentation, becoming dark dorsally and silver ventrally (called silver eels). Silver eels are also characterized by a clear contrasting black lateral line and enlarged eyes (Ref. 6125). At the end of their growth period, they become sexually mature, migrate to the sea and cover great distances during their spawning migration (5,000-6,000 km); with extensive daily vertical migrations between 200 m at night and 600 m during day time, possibly for predator avoidance (Ref. 89140). Gametogenesis occurs entirely during spawning migration. Average life span is usually 15-20 years (Ref. 88171). Male eels can grow up to 50 cm TL (Ref. 39903). Occurs at temperatures ranging from 0-30°C (Ref. 172). Its food includes virtually the whole aquatic fauna (freshwater as well as marine) occurring in the eel's area, augmented with animals living out of water, e.g. worms (Ref. 172). Best temperature for making eels sexually mature is 20-25°C (Ref. 35388). Sensitive to weak magnetic fields (Ref. 89141, 89142). Their high fat content and benthic feeding habits in continental waters make them vulnerable to the bioaccumulation of pollutants, such as heavy metals and organic contaminants, that may result in organ damage and impaired migration capability (Ref. 82710) and lowered genetic variability (Ref. 82711). Review of information supports the view that the European eel population as a whole has declined in most areas, the stock is outside safe biological limits and current fisheries not sustainable (Ref. 82712). Obvious decreasing of the stocks for all the continental native distribution area (Ref. 40476). Utilized fresh, dried or salted, smoked and frozen; can be fried, boiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The common eel is long and snake-like in shape with a tough, slimy skin. The dorsal fin starts on the back some way behind the gill slits and small pectoral fins and runs the length of the body. At the tail the dorsal fin merges with the ventral fin, that runs along the underside of the body. The eel can be black, brown or dark olive green in colour above, paler and yellowish on the underside. Sexually maturing eels become silver rather than yellow.Anguilla anguilla has a complex life history that is poorly understood. It involves migration of mature adults from European rivers and estuaries to the Sargasso Sea in the west Atlantic for spawning, and the subsequent return of juveniles. They metamorphose twice, part of the life cycle spent in fresh water and part in estuarine or full sea water (Whitehead et al., 1986). The adult eels and the returning juveniles (elvers) are commercially fished. The common eel has small eyes and its lower jaw projects from the upper, which distinguishes it from the conger eel, Conger conger. In the common eel the dorsal fin arises about a head's length behind the gill slits and pectoral fins while in the conger eel the fin arises further forward, from just behind the pectoral fins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Baltic sea, Belgian Exclusive Economic Zone, Black Sea, British Isles, European waters (ERMS scope), Grevelingen, Gulf of Maine, IJsselmeer, Israeli part of the Mediterranean Sea - Eastern Basin, North West Atlantic, Oostende, Oosterschelde, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Sas van Goes, Schelde estuary, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic Ocean: Atlantic coast from Scandinavia to Morocco; Baltic, Black and Mediterranean Seas; rivers of North Atlantic, Baltic and Mediterranean seas (Ref. 172, Ref. 51442). Continuous introductions to Asia and South and Central America. Spawning area in western Atlantic (Sargasso Sea). At least one country reports adverse ecological impact after introduction. Recent genomic DNA studies show that the European eel exhibits isolation by distance, implying that non-random mating and restricted gene flow among eels from different location exists (Ref. 43723). The existence of 3 genetically distinct sub-populations is suggested: a Northern European subpopulation (consisting mainly of the Icelandic stocks); a Western European subpopulation (including the Baltic, the Mediterranean and Black Sea); a Southern sub-population (including stocks of Morocco) (Ref. 43723, 89139). International trade restricted (CITES Appendix II, since 13.5.2009).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Anguilla anguilla is found in all European rivers draining to the Mediterranean, North and Baltic seas, in the Atlantic south to Canary Islands and parts of Mediterranean north Africa and Asia. It very rarely enters the White and Barents seas, but is recorded eastward to the Pechora River in northwest Russia. The species occurs in low abundance in the Black Sea where it migrates east to the Kuban drainage (occasional individuals reach the Volga drainage through canals), in northern Scandinavia and eastern Europe, but 'trap-and-transport' stocking is interfering with natural population numbers (W. Dekker pers. comm. 2007). Large parts of the population remain at sea particularly in the north western Atlantic and Mediterranean. It is also widely stocked in most inland waters of Europe.

The species is thought to breed in the Sargasso Sea in the West Central Atlantic, migrating across the Atlantic from Europe.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The geographic range of adult European eels includes the English Channel and coasts of the Mediterranean Sea and northern Atlantic Ocean from Iceland to Mauritania (Ringuet et al., 2002). Their range also encompasses the Baltic and North Seas, as well as all accessible continental or coastal hydrosystems (Ringuet et al., 2002). In the early spring months, European eels migrate to the Sargasso sea for breeding. Larvae are hatched from the Sargasso Sea and can also be found along the coast of Europe. Silver (juvenile) stage eels of Anguilla anguilla live in tributaries along the European coast.

Biogeographic Regions: palearctic (Native ); atlantic ocean (Native ); mediterranean sea (Native )

  • Tsukamoto, K., I. Nakai, W. Tesch. 1998. Do all freshwater eels migrate?. Nature, 396: 635-636.
  • Ringuet, S., F. Muto, C. Raymakers. 2002. Eels: Their Harvest and Trade in Europe and Asia. Traffic Bulletin, 19/2: 2-27.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rivers of North Atlantic, Baltic and Mediterranean seas. Continuous introductions to Asia and South and Central America, but not reproducing. Spawning area in western Atlantic (Sargasso Sea). Also distributed along the coast of Europe from the Black Sea to the White Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western and Eastern Atlantic, Baltic Sea, North Sea, Mediterranean Sea, Black Sea, Sea of Marmara: European seas and adjacent watersheds, spawing and larval migration routes to and from the western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the rivers of the North Atlantic, Baltic and Mediterranean Seas; it also occurs along European coasts from the Black Sea to the White Sea in Russia. Spawning takes place in the Sargasso Sea in the western Atlantic (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0; Vertebrae: 110 - 120
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The appearance of European eels varies greatly depending on life stage. As leptocephali, European eels are small, leaflike, and transparent (Deelder, 1970). After metamorphosing into the silver stage, European eels appear silvery in color with elongated dorsal and anal fins that are continuous with the caudal fin (Deelder, 1970). European eels lack pelvic fins (Deelder, 1970). Upon full sexual maturation, European eels develop enlarged eyes, lose their ability to feed, and turn green, yellow or brownish in color (Van Ginniken and Thillhart, 2000).

Female eels are generally substantially larger than males. The largest recorded mass of a female eel is 6.599 g (Dekker, van Os and van Willigen, 1998). The maximum published length of a European eel was 133 cm.

Range mass: 6,599 (high) g.

Range length: 133 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Van Ginneken, V., G. Van Den Thillart. 2000. Physiology: Eel fat stores are enough to reach the Sargasso. Nature, 403: 156-157.
  • Dekker, W., B. van Os, J. van Willigen. 1998. Minimal and maximal size of eel.. L'ANGUILLE EUROPENNE. 10E REUNION DU GROUPE DE TRAVAIL "ANGUILLE" EIFAC/ICES..
  • Deelder, C. 1970. Synopsis of biological data of the eel Anguilla anguilla (Linnaeus, 1758). FAO Fish. Synop., 80: 68.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 3506)); 133 cm TL (female); max. published weight: 6,599 g (Ref. 39903); max. published weight: 2,850.0 g; max. reported age: 88 years (Ref. 72468)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Elongated, anguilliform body (Ref. 51442), cylindrical anteriorly, somewhat compressed posteriorly (Ref. 6125). Lower jaw slightly longer and projecting (Ref. 6125, Ref. 51442). Gill openings small and vertical, restricted to the sides (Ref. 6125). Elongated dorsal and anal fins, confluent with caudal fin (Ref. 6125, Ref. 51442), forming one unique fin from the anus to the middle of the back with minimum 500 soft rays (Ref. 40476). Dorsal fin origin far behind pectoral fins; anal fin origin slightly behind anus, well back from origin of dorsal fin (Ref. 6125). Pelvic fins absent (Ref. 2196, Ref. 51442). Greenbrown colored (Ref. 51442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 700 m (Ref. 54218)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
The species is found in all types of benthic habitats from small streams to shores of large rivers and lakes. Naturally it only occurs in water bodies that are connected to the sea; it is stocked elsewhere.

Biology:
The species is catadromous, living in fresh water but migrating to marine waters to breed. While its life in freshwaters are well understood, relatively little is known about its life history at sea. The spawning peaks at the beginning of March continuing until July, and the adults probably die after spawning. There are no concrete data about specific spawning, however, it is assumed that spawning takes place only in an elliptic zone, about 2,000 km wide in the Sargasso Sea, in the West Central Atlantic (about 26°N 60°W). The mechanisms by which leptocephali reach the European coasts are not also well understood. By the time the leptocephali reach the continental slope they are about 70 mm in size and metamorphose into glass-eels which are almost adult in appearance, but have a transparent body, and enter estuaries. These glass-eels are observed in the autumn on Portuguese coasts, and in winter and spring in the North Sea. The generation length of the species varies greatly and ranges from 2 to 50 years, and having a typical mean of 20 years with females being twice the size and age of males (W. Dekker pers. comm. 2007).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depending on the lifestage of the individual eel, European eels can be found in marine, freshwater, and brackish aquatic environments. Typically, the European eel is found in depths of 0-700 m, most often on the floor of the ocean or river in which it is living.

Range depth: 0 to 700 m.

Habitat Regions: saltwater or marine ; freshwater

Aquatic Biomes: benthic ; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters.Spawning occurs in Sargasso Sea, leptocephali drift for about 3 years across Atlantic to brackish waters, after several years, return migration back to Sargasso Sea.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9725 specimens in 2 taxa.
Water temperature and chemistry ranges based on 210 samples.

Environmental ranges
  Depth range (m): -9 - 615
  Temperature range (°C): 3.141 - 21.403
  Nitrate (umol/L): 0.194 - 17.847
  Salinity (PPS): 6.114 - 38.613
  Oxygen (ml/l): 2.113 - 8.276
  Phosphate (umol/l): 0.035 - 1.740
  Silicate (umol/l): 0.885 - 50.947

Graphical representation

Depth range (m): -9 - 615

Temperature range (°C): 3.141 - 21.403

Nitrate (umol/L): 0.194 - 17.847

Salinity (PPS): 6.114 - 38.613

Oxygen (ml/l): 2.113 - 8.276

Phosphate (umol/l): 0.035 - 1.740

Silicate (umol/l): 0.885 - 50.947
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The adult eel is most abundant in estuaries and low salinity pools but is also found around the coast in permanent tide pools, on the lower shore and shallow sublittoral. Being nocturnal it is inactive during the day under rocks or weed or in soft sediments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Part of the common eel's life cycle is spent in the sea, and part in freshwater rivers. It is often common on the shore (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Observations have shown that scent and taste appear to be more important than sight for foraging purposes (Ref. 172). Smaller individuals feed mainly on insect larvae, molluscs, worms, and crustaceans; subadults on benthic invertebrates and fish (Ref. 51442); larger individuals on other fishes. This species can also be a scavenger, feeding on carcasses. Yellow and silver eels are nocturnal and opportunistic feeding on virtually all small animals they encounter. Cannibalism occurs amongst yellow eels (Ref. 172). Feeding ceases when silver eels start their spawning migration and rely on their lipid reserves for energy. Leptocephali feed on gelatinous zooplankton (e.g. Hydrozoa, Thaliacea and Ctenophora) (Ref. 89143).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

European eels have completely different diets during different life stages. No food contents have ever been discovered in the guts of leptocephali, therefore their diet is unknown (Fisheries Global Information System, 2005). Glass eels consume insect larvae, dead fish, and small crustaceans (Sinha and Jones, 1975). Adult eels have a fairly broad diet and eat freshwater, marine, or terrestrial fauna. Their primary food source is aquatic invertebrates, but they will eat essentially any food they can find-- even dead organisms (Sinha and Jones, 1975). European eels are reported to leap out of the water during the winter and feed on terrestrial invertebrates (Deedler, 1970).

Animal Foods: fish; eggs; carrion ; insects; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; zooplankton

Other Foods: detritus

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates, Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus lucii endoparasitises anterior intestine of Anguilla anguilla

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Anguilla anguilla

Animal / parasite / ectoparasite
Ergasilus gibbus ectoparasitises gill of Anguilla anguilla

Animal / parasite / endoparasite
Trypanosoma granulosum endoparasitises blood of Anguilla anguilla
Other: sole host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

European eels are both a food source and a predator of organisms in their ecosystem. They are consumed by birds and large predatory fish (Deelder, 1970). European eels also act as a host for the nematode Aguillicola crassus which infects the swim bladders of European eels (Deelder, 1970). European eels distribute nutrients between marine and freshwater ecosystems because they migrate between those habitats (Deelder, 1970).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

European eels are preyed upon by larger eels and other fish and fish-consuming birds, such as cormorants (Phalacrocorax) and herons (Ardeidae) (Deelder, 1970). One defense mechanism employed by eels is that they hide under rocks and burrow in the sand, thus avoiding their predators. The coloring of eels at various life stagies (i.e. the transparency of leptocephali, the dark grey to green color of adults, etc.) also serves as camouflage.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Anguilla anguilla (Anguilla anguilla eel) is prey of:
Lutra lutra
Phalacrocorax carbo
Ardea cinerea
Sterna paradisaea
Platichthys flesus
Podocotyle staffordi
Derogenes varicus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Anguilla anguilla (Anguilla anguilla eel) preys on:
Tanypus punctipennis
Blicca bjorkna
Acerina cernua
Crangon crangon
Nereis diversicolor
Neomysis integer
Corophium volutator
Gammarus
Jaera albifrons

Based on studies in:
Austria, Neusiedler Lake (Lake or pond)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • F. Schiemer, The benthic community of the open lake. In: Neusiedlersee: The Limnology of a Shallow Lake in Central Europe, H. L ffler, Ed. (Dr. W. Junk, The Hague, Netherlands, 1979), pp. 337-384, from p. 376.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Worm Cataract. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vibriosis of eel (acute). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vibriosis Disease (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Triaenophorus Disease (juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Streptococcal Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skin Fungi (Saprolegnia sp.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudodactylogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pomphorhynchus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Podocotyle Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleistophora disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neoechinorhynchus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Intestinal Ligulosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gyrodactylogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Glugea. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flexibacter Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diphyllobothrium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camallanus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Branchiomyces Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anguillicola Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anchor worm Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

European eels sense the environment using their sense of taste. They have been shown to locate necessary amino acids via chemotaxis (Sola and Tongiorgi, 1998). European eels also utilize olfaction, most probably for homing purposes. There is little if any documentation of social communication between eels (Deelder, 1970).

Perception Channels: visual

  • Sola, C., P. Tongiorgi. 1998. Behavioural responses of glass eels of Anguilla anguilla to non-protein amino acids. Journal of Fish Biology, 53/6: 1253.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Catadromous species. When sexual maturity is reached they leave the river. Spawning migrations occur mainly during the second half of the year but have been observed year-round, usually commencing during dark nights (Ref. 172). Maturity is obtained during the spawning migration (Ref. 88171). Actual spawning has never been observed but is believed to occur solely in the Sargasso Sea between March and June (Ref. 89144). After spawning (at 600 m depth) adults die. Sigmund Freud described the testicles of eel (Ref. 72449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

European eels begin their life cycle as eggs on the bottom of the Sargasso Sea. They hatch as leptocephali, leaf-like larvae (Tsukamoto, Nakai and Tesch, 1998). After hatching, larvae spend a maximum of one year migrating to Europe, or occasionally North America, via ocean currents. The larvae will then metamorphose into 'glass eels,' the next stage of the life cycle, and enter estuarine areas. Male glass eels contineu to grow for approximately 6 to 12 years; females for 9 to 20 years (Deelder, 1970). After a final metamorphosis, European eels migrate back to the Sargasso Sea to spawn.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of European eels is dependent on maturation time because once eels mature and spawn, they die. European eels can spawn as early as 7 years old. The maximum reported age of a European eel in the wild is 85 years (Dekker, van Os and van Willigen, 1998).

Range lifespan

Status: wild:
85 (high) years.

Typical lifespan

Status: wild:
7 (low) years.

Average lifespan

Status: captivity:
55.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 88 years (captivity) Observations: In the wild, these semelparous animals die after first spawning. After transformation from juvenile to adult stage they do not eat and feature elevated corticosteroids while they migrate to the Sargasso Sea to spawn. Preventing migration by keeping animals in captivity significantly extends lifespan. One female called "Putte", generally assumed to be a European eel, died at Halsinborgs Museum in Sweden at about 88 years of age (Caleb Finch 1990). In the wild, animals do not commonly live more than 10-15 years, though it is possible some live up to 30 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Upon reaching sexual maturity, European eels migrate from freshwater streams back to the Sargasso Sea in order to spawn and die in the late winter months to the early summer months. European eel males release sperm into the water in which female European eels have already laid eggs, thereby fertilizing the eggs (Horie et al., 2004). Very little is known about the actual spawning mechanism, and time to hatching is variable.

Mating System: polygynandrous (promiscuous)

European eels spawn during the late winter to early spring months. There is little information on their reproduction, but since European eels are closely related to Japanese eels, Anguilla japonica, similar breeding patterns might be assumed. Female A. japonica can lay from 2,000,000 to 10,000,000 eggs, but die soon after spawning (Deelder, 1970). Eel larvae are independent from time of birth until time of death.

Breeding interval: European eels breed only once during their lifetime. Once spawning is complete, European eels die .

Breeding season: European eels spawn in late winter to early spring.

Range number of offspring: 2,000,000 to 10,000,000.

Range age at sexual or reproductive maturity (female): 9 to 20 years.

Range age at sexual or reproductive maturity (male): 6 to 12 years.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

European eels invest a substantial amount of energy in reproduction, and die shortly thereafter (Deelder, 1970). Consequently, the only resource that female eels give to their offspring is enough food source to last the egg until hatching. After hatching, the larvae are completely independent and able to find food (Lecomte-Finiger, 1994).

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

  • Lecomte-Finiger, R. 1994. The Early Life of the European Eel. Nature, 370: 424-425.
  • Okamura, A., H. Zhang, T. Utoh, A. Akazawa, Y. Yamada, N. Horie, N. Mikawa, S. Tanaka, H. Oka. 2004. Artificial hybrid between Anguilla anguilla and A. japonica. Journal of Fish Biology, 64/5: 1450.
  • Deelder, C. 1970. Synopsis of biological data of the eel Anguilla anguilla (Linnaeus, 1758). FAO Fish. Synop., 80: 68.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Senses help navigate during migration: European eel
 

European eels navigate during long migrations by being sensitive to many different types of stimuli.

   
  "Those specimens that do complete their life cycle use many environmental cues to navigate during their migration. Not only are eels highly sensitive to olfactory stimuli, they also respond readily to small fluctuations in water movements, seismic activity, and even to the minute electrical fields generated by water currents." (Shuker 2001:74-75)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla anguilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTCGTATTTGGTGCCTGAGCCGGAATAGTCGGCACTGCACTGAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGATTTGGCAACTGACTTGTGCCATTAATAATCGGCGCCCCAGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTTTACCCCCATCATTTCTTCTACTACTAGCCTCCTCTGGAGTAGAGGCCGGAGCTGGTACAGGCTGAACTGTATATCCACCCCTGGCTGGAAACTTAGCCCACGCTGGGGCATCTGTTGACCTGACAATTTTCTCACTCCACCTTGCAGGTATTTCATCAATTCTAGGGGCCATTAACTTTATTACTACAATTATTAACATGAAACCGCCTGCAATTACACAGTACCAAACTCCCCTGTTTGTATGAGCTGTATTAGTAACCGCCGTTTTACTACTCCTCTCCCTGCCAGTCCTAGCCGCAGGCATTACAATACTTCTGACTGACCGAAATCTAAATACGACCTTCTTTGATCCTGCAGGGGGTGGAGACCCAATCCTCTACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACATATTGTTGCTTATTATTCCGGAAAGAAAGAACCATTTGGCTATATAGGAATAGTCTGAGCAATGATGGCCATCGGACTACTAGGATTCATCGTATGAGCACACCATATGTTTACGGTCGGAATAGACGTAGACACTCGTGCTTACTTCACTTCCGCCACAATAATTATCGCAATTCCAACTGGGGTAAAAGTATTCAGCTGACTAGCCACATTACATGGAGGCGTTATCAAATGAGAAACCCCACTTCTTTGAGCTTTAGGTTTTATTTTCCTATTCACAGTTGGAGGCCTAACAGGCATTGTTCTAGCAAACTCATCAATCGACATTGTATTACATGATACATACTATGTAGTAGCCCACTTCCATTATGTTCTGTCCATAGGGGCAGTATTTGCTATTATGGGAGGCTTTGTACACTGATTCCCCTTATTTTCAGGCTATACACTACACGACACATGAACCAAAGTACACTTTGGGATTATGTTCGTAGGGGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGCTTAGCAGGAATACCACGGCGTTACTCAGATTACCCAGATGCCTATACCCTATGAAATACAATCTCCTCTATCGGATCCCTAATTTCTCTCACAGCCGTAGTCCTATTCCTATTTATCCTATGAGAAGCATTTACTGCTAAACGAGAGGTAAAATGAGTAGAACTTACAGAAACAAATGTTGAATGACTACATGGATGTCCTCCACCATATCACACATTCGAAGAACCAGCATACGTCCGAGTTCAACCCCCATCAGATGATAAAAAATCAGAAGCCAAAGCCCATATTCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla anguilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2010

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Wickström, H. & Smith, K.

Contributor/s

Justification

The species has undergone a sharp decline in recruitment, yield and stock, which will continue into the future.

The recruitment of glass eels has declined from 1980, and since 2000 is at an historical low at just 1-5% of the pre-1980 levels, showing a 95 to 99% decline. This recent decline in recruitment will translate into a future decline in adult stock, at least for the coming two decades (ICES 2006).

Yield and stock abundance have declined since the 1960s. As the recruitment rate is so low the population is continuing to decline as older eels disappear from the stock. According to the FAO global catch landings (which cannot be directly linked to population due to stocking and harvest effort, though scientific evidence supports this decline) show that in 2005 only 4,855 tonnes were caught, a decline of 76% since a harvest peak in 1968, 37 years earlier (three generations of the species is estimated to be 60 years).

Even though the exact cause of the decline in recruitment is not known the species has many threats. The level of harvest of the species according to the International Council for the Exploration of the Seas (2006) is currently unsustainable. A nematode parasite (Anguillicola crassus) from introduced eels from Japan is suspected to impact the ability of the eels to reach the spawning grounds. Dams (for hydropower) are also a threat to the species by blocking migration routes and by causing high mortality rates as downstream migrating eels are killed by turbines. Pollution, loss of wetlands and climate change are also potential threats to the species.

Although a reliable population decline in mature individuals is not known, it is inferred that there has been a decline of over 80% in the past three generations (60 years) based on the massive decline in recruitment (95% in 24 years) which is supported by the decline in catch landings of 76% between 1968 and 2005 (37 years). This decline is likely to continue. Full and immediate protection is required and ICES have recommended that a recovery plan be developed for the whole stock on an urgent basis.

Action has already been taken at the international level, but the impacts of this will not be detected for many years. In 2007, CITES listed the species in Appendix II (this came into force in March 2009) and will require exporting states to have an export permit which can only be issued if the export will not be detrimental to the survival of the species. Also the European Commission has issued a Regulation requiring all member states to produce eel management plans, amongst other measures. These management plans were required to be in place by July 2009 and have the objective to permit the escapement to the sea of at least 40% of the silver eel biomass [relative to the estimated stock levels in the absence of human influences].


History
  • 2006
    Not Evaluated
    (IUCN 2006)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European eel populations are not currently threatened.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Glass eels:
Since the early 1980s, a steady and almost continent wide decline of 90% has been observed in the recruitment of glass (juvenile) eels (Dekker 2003). According to an ICES and FAO report (2006) European Eel recruitment levels reached an historical low in 2001 of 1 to 2% of the pre-1980 level, this has not improved and is an indication that the reproduction is seriously impaired and that the stock is severely depleted. In recent years, no substantial recovery in recruitment has been observed (Dekker 2007). This recent decline in recruitment will translate into a future decline in adult stock, at least for the coming two decades (ICES 2006).

Yellow/silver eels:
Even though there is no analytical assessment of the state of the [continental] European Eel stock, all available information indicates that the stock is at an historical minimum in most of the distribution area and continues to decline (ICES and FAO 2006). Unfortunately, a total continental stock assessment cannot be made as it is hard to monitor, being scattered over millions of rivers, lakes, estuaries, etc. (Dekker 2000). However, even though catch effort can be variable and under reporting of landings is a serious problem in most European countries, trends in the reported catch data will to some extent reflect true changes in fishing yields. According to FAO global capture statistics (exploited at all stages of their freshwater life), capture peaked in 1968 with 20,278 tonnes, in 1975 this had dropped to 16,110 tonnes, in 1985 it was 12,665 tonnes, 1995 8,706 tonnes and the most recent available figure in 2005 was 5,059 tonnes a decline of 76% since the peak in 1968. This is supported by the possibly only long-term scientific data [from Lake Ijsselmeer in the Netherlands] where there has been a gradual decline since 1960 (Dekker 2004a). However, there is also evidence that in Norway catches seem to be stable over this period (ICES 2002).

The overall population is continuing to decline as the older eels disappear from the stock and recruitment rate is so low and declining. Noting the longevity of the species, and the extremely depleted state, restoration of the stock is expected to take several generations from 60 to 200 years depending on the protection level (Astrom and Dekker 2007). Temporary increases (over 10-15 years) in abundance following the implementation of protective measures thus do not guarantee ultimate recovery, if not severely protecting the stock (W. Dekker pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The causes of the declining recruitment rates are still unclear (Dekker 2007), but there are many hypotheses:

The North Atlantic Oscillation (NAO) may have reduced larval survival and/or growth rate (Castonguay et al. 1994). However, Dekker (2004b) shows that the NAO index correlation is strong for growth rate but weak for glass eel numbers as in 2000 the NAO index returned to normal but recruitment still declined.

Overfishing for glass eels (mainly in France, Spain, Portugal and UK) and downstream migrating eels (silver eels) across Europe (W. Dekker pers. comm.) is also a threat to the species. The demand from Asia and Europe for glass eels is huge and the price is increasing (750 Euro per kilo in 2006 from around 100 Euro in 1990.). According to ICES (2006) Anguilla anguilla fisheries are currently not sustainable, and a recovery plan urgently needs to be developed for the whole stock.

There is also a parasite nematode (Anguillicola crassus), from introduced eels from Japan which is suspected to impact the ability of the European Eels to reach their spawning grounds.

Dams (for hydropower and water management) are also a threat to the species by blocking migration routes and also through causing high mortality rate as the downstream migrating eels are killed by turbines.

Climate change may be having an impact on the suspected breeding grounds (Sargasso Sea).

Increasing numbers of predators, in particular cormorants, across Europe may also have a negative impact on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The population of the common eel is threatened at present, and eel stocks have declined in recent years. However, there is currently very little scientific knowledge of this species, which would aid its management. The threats facing the species are unknown, however, pollution, overfishing, habitat degradation, parasite infection and changes in climate have all been forwarded as potential causes of the decline (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The majority of conservation actions historically in place for the European Eel were set up and controlled at local and national level. Their aims are often securing fishing rights, supporting local stock levels and sustainable income for fishing communities and not to increase recruitment.

However, in 2007 two major multi-lateral bodies recognized the state of the European Eel and have acted upon it.

The European Council (EC) Regulation No 1100/2007 establishing measures for the recovery of the stock of European Eel was published in September 2007. The Regulation required, by 1 July 2009, all member states that contain natural habitats of the European Eel to establish eel management plans at a river basin scale. The objective of these plans was to permit the escapement to the sea of at least 40% of the silver eel biomass [relative to the estimated stock levels in the absence of human influences], through various measures including reducing commercial and recreational fisheries, restocking, measures to improve habitats and make rivers passable, transportation of silver eels to the sea and monitor eel status in each basin. The Regulation also requires that by 31 July 2013, 60% of eels less than 12 cm in length caught annually should be reserved for restocking [and not aquaculture], also that over a 5 year period starting from 1 July 2009 catches or fishing effort of eels in coastal and sea waters [i.e. beyond river basin plan] should be reduced by at least 50% [of average between 2004-2006], and that a control and monitoring system be set up by each member state.

The European Eel was listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) in June 2007. The listing came into effect on 13 March 2009, after which time all Parties to the Convention will be required to issue permits for all exports of the species. An export permit may be issued only if the specimen was legally obtained and if the export will not be detrimental to the survival of the species. In the European Union, which includes 24 eel range States, CITES is implemented through Council Regulation 338/97 and Commission Regulation 865/2006 which require both import and export permits to be issued for species listed in Annex B of the Regulation (Annex B contains most CITES Appendix II species). In the case of specimens introduced from the sea, a certificate has to be issued by the Management Authority of the State into which the specimens are being brought, for species listed in Appendix I or II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The European Union is currently funding research that aims to halt the decline of the common eel population (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

European eels thrive on a diet of marine and freshwater fauna, so impact populations of other marine and freshwater organisms (Deelder, 1970). There are no direct adverse effects to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

European eels are a popular food source for humans, especially in Europe and Asia. The eels also feed on the eggs of predatory fish such as trout, which keep ecosystems from overpopulation (Deelder, 1970).

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European eel

The European eel, Anguilla anguilla,[1] is a species of eel, a snake-like, catadromous fish. They can reach (in exceptional cases) a length of 1.5 m (4 ft 11 in), but are normally much smaller, about 60–80 cm (2.0–2.6 ft), and rarely more than 1 m (3 ft 3 in).

Contents

Life history[edit]

Life cycle of an eel

Much of the European eel’s life history was a mystery for centuries, as fishermen never caught anything they could identify as a young eel. Unlike many other migrating fish, eels begin their life cycle in the ocean and spend most of their lives in fresh water, returning to the ocean to spawn and then die. In the early 1900s, Danish researcher Johannes Schmidt identified the Sargasso Sea as the most likely spawning grounds for European eels.[2] The larvae (Leptocephalus) drift towards Europe in a three-hundred-day migration.[3] When approaching the European coast, the larvae metamorphose into a transparent larval stage called "glass eel", enter estuaries and start migrating upstream. After entering fresh water, the glass eels metamorphose into elvers, miniature versions of the adult eels. As the eel grows, it becomes known as a "yellow eel" due to the brownish-yellow color of their sides and belly. After 5–20 years in fresh water, the eels become sexually mature, their eyes grow larger, their flanks become silver and belly white in color. In this stage the eels are known as "silver eels", and they begin their migration back to the Sargasso sea to spawn.

Conservation status[edit]

The European Eel is a critically endangered species.[4] Since the 1970s, the numbers of eels reaching Europe is thought to have declined by around 90% (possibly even 98%). Contributing factors include overfishing, parasites such as Anguillicola crassus, barriers to migration such as hydroelectric plants, and natural changes in the North Atlantic oscillation, Gulf Stream and the North Atlantic drift. Recent work suggests that PCB pollution may be a factor in the decline.[5]

Eels have been important sources of food both as adults (including the famous jellied eels of East London) and as glass eels. Glass eel fishing using basket traps has been of significant economic value in many river estuaries on the western seaboard of Europe.

In captivity European eels can become very old.[6]

Sustainable consumption[edit]

In 2010, Greenpeace International has added the European eel to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[7]

Decreasing population numbers and breeding projects[edit]

For quite some time, the population number of European eels has been falling. For this reason, a research project has been started by Innovatie Netwerk, led by Henk Huizing to see whether it is possible to breed European eels in captivity. The breeding of European eel is very difficult, since eel is generally only able to reproduce after having swum a distance of 6,500 kilometres (4,000 mi). In the project, this is being simulated by means of a hometrainer for the fish. Innovatie Netwerk has also started a breeding project, called InnoFisk Volendam.[8][9]

Commercial fisheries[edit]

Total production of European eel in thousands of tonnes as reported by the FAO, 1950–2010[10]

Gallery[edit]

References[edit]

  1. ^ "Anguilla anguilla". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  2. ^ Schmidt, J. (1912) Danish researches in the Atlantic and Mediterranean on the life-history of the Fresh-water Eel (Anguilla vulgaris, Turt.). Internationale Revue der gesamten Hydrobiologie und Hydrographie 5: 317-342.
  3. ^ "FAO Fisheries & Aquaculture Anguilla anguilla". Fao.org. 2004-01-01. Retrieved 2012-08-02. 
  4. ^ The IUCN Red List of Threatened Species, 2008.
  5. ^ "PCBs are killing off eels". New Scientist 2452: 6. 2006. 
  6. ^ (Swedish) Branteviksålen kan vara världens äldsta, 2008.
  7. ^ Greenpeace International Seafood Red list
  8. ^ EOAS magazine, september 2010
  9. ^ Innofisk Volendam breedign project
  10. ^ a b c Based on data sourced from the FishStat database, FAO.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!