Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Eels are mysterious fish. It is still unknown as to where the females lay their eggs. Juvenile eels look very different than adults so that people also used to think that they were two different species of fish. Eel can live in fresh as well as salt water. As long as the ground is wet enough, they can move on land. Eels are momentarily threatened by overfishing. Obstacles between fresh and salt water also form a problem. In 2007, the eel was declared as a protected animal species. A European recovery plan has been developed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The European eel, Anguilla anguilla, is one of 19 species in their genus, found in the Northern Atlantic south to Mauritius, the Mediterranean, North and Baltic Seas and the rivers that feed into these ocean bodies.  They are a popular food fish, and have been fished for centuries.  Like other anguillid eels, European eels have a complex life history, spending most of their life in the “yellow eel” growth phase, during which they inhabit the bottoms of fresh and brackish continental waters.  European eels can live more than 50 years in this stage, but more typical is about 20 years; females generally live longer than males and grow to be about twice the size.  The record length for a female European eel is 133 cm (4.4 feet).  Upon reaching sexual maturity, the eels, now in the “silver eels” phase, migrate long distances to spawn in the Sargasso Sea in the western Atlantic between March and July.  This migratory phase of their lifestyle is recently described, poorly understood.  Adults die after spawning.  The planktonic larvae, which until recently had been described as a separate species as they look so different from adults, hatch at sea and drift back to continental waters where they develop into small, transparent “glass eel” larvae.  They metamorphose into the pigmented elver stage as they begin to feed and travel to freshwater inland rivers, lakes, streams and estuaries to complete their development.  Nocturnal opportunist carnivores, they eat a broad diversity of fish and invertebrates, and will also scavenge on dead organisms. 

The European eel is critically endangered, its population in a significantly depleted state such that the IUCN cites that it may not in fact be able to recover unless a long-term, stringent recovery plan is instated.  Since 1980 it has experienced a disappearance of older eels and a 90% reduction in the recruitment of its glass-eel stage across the full extent of its range, and there is no sign of population recovery.  The full explanation for the recruitment and population crash of these eels is not fully understood.  Heavy, unsustainable fishing of all life stages continues to impact a downward decline of the population.  Its popularity especially in Asian cuisine brings enormous demand and extremely high prices.  As yet, anguillid eels have not been bred in captivity but captured glass eel stages are widely farmed.  In addition to overfishing, A. anguilla suffers from a nematode parasite, Anguillicola crassus, introduced by Japanese eels (A. japonica) farmed in Europe in large open pens alongside A. anguilla.  European eel decline is also partly due to habitat loss and degredation, dams, which disrupt migration routes, climate change effecting spawning areas, and other anthropomorphic activity.  Seafood Watch, a highly-regarded sustainable seafood advisory list, recommends that consumers avoid eating A. anguilla.

(Freyhof and Kottelat 2010; Halpin 2007)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The common eel has a fascinating life-cycle; it is a 'catadromous' species, breeding in the sea and migrating to freshwater in order to grow before returning to the sea to spawn (4). It is thought that all European eels spawn in the Sargasso Sea. The larvae, which look like curled leaves and are known as 'leptocephalli', drift in the plankton for up to three years (2), and are carried by the Gulf Stream towards the coasts of Europe (3). They then undergo metamorphosis into young eels; at this stage they are known as 'glass eels' because they are transparent (2). They become darker in colour and start to migrate up freshwater streams in large numbers; they are known as 'elvers' at this time and measure around 50 mm in length (2). The eels, now called 'brown' or 'yellow eels' grow in freshwater (5), with males and females spending 6 to 12 and 9 to 20 years in freshwater, respectively (3). Towards the end of this time, they become sexually mature; they turn a silvery colour and migrate back towards the sea on dark, moonless and stormy nights; during this time they are known as 'silver eels' (5). Upon returning to the sea, the common eel lives in mud, crevices, and under stones (3). Spawning occurs during winter and early spring in the Sargasso Sea (3). This is a very long-lived species with a maximum life span of 85 years (3). This eel is predated upon by birds, including cormorants and gulls, as well as a number of species of fish (3). Remarkably, they can survive out of water for several hours on damp nights; they may travel overland on dark rainy nights (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The common or European eel has a very unusual and fascinating life cycle. Adults have long, narrow bodies, with a continuous dorsal, anal and tail-fin (2). The skin is slimy, the lower jaw is longer than the upper jaw, and the scales are tiny or absent (2). The colour of adults depends on their age; they are often brown, black or olive-green with yellowish bellies. Some adults may be silvery (known as 'silver eels'); the lifecycle stages differ greatly in appearance (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Anguilla anguilla (Linnaeus, 1758)

Mediterranean Sea : 3200-727 (1 spc.), October 2002 , Iskenderun Bay , trawl , C. Dalyan . Inland water: 3200-537 (1 spc.), 20.03.1995 , Menderes River , Söke-Ayd ; 3200-50 (4 spa), 20.03.1995 , Menderes River , Sôke-Ayd ; 3200-807 (1 spa), 07.03.2001 , Asi River , Kumlu-Hatay , C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 33-33, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits all types of benthic habitats from streams to shores of large rivers and lakes. Naturally found only in water bodies connected to the sea (Ref. 59043). Territorial and solitary species; 'schools' of young eels which are observed from time to time are a mass response to outward conditions and not of active assembling (Ref. 172). Amphihaline (Ref. 51442). Migrates to the depths of the Sargasso Sea to spawn (Ref. 172, 51442). Eel larvae (leptocephali) are transparent ribbon-like. They are brought to the coasts of Europe by the Gulf Stream in 7 to 11 months time (Ref. 51442) and can last for up to 3 years (Ref. 8994). They are transformed into glass eels (6-8 cm length, cylindrical in shape and transparent to slightly pigmented in colour). They enter the estuaries and colonize rivers and lakes (Ref. 11941, 51442); some individuals remain in estuaries and coastal waters to grow into adults (Ref. 88171). The glass eel stage is followed by a long feeding period (from the yellow to the silver eel stage) lasting 6-12 years in males (Ref. 6125) and 9-20 years in females (Ref. 6125). Yellow and silver eels are benthic, found under stones, buried in the mud or in crevices (Ref. 89138). Yellow eels eventually lose their pigmentation, becoming dark dorsally and silver ventrally (called silver eels). Silver eels are also characterized by a clear contrasting black lateral line and enlarged eyes (Ref. 6125). At the end of their growth period, they become sexually mature, migrate to the sea and cover great distances during their spawning migration (5,000-6,000 km); with extensive daily vertical migrations between 200 m at night and 600 m during day time, possibly for predator avoidance (Ref. 89140). Gametogenesis occurs entirely during spawning migration. Average life span is usually 15-20 years (Ref. 88171). Male eels can grow up to 50 cm TL (Ref. 39903). Occurs at temperatures ranging from 0-30°C (Ref. 172). Its food includes virtually the whole aquatic fauna (freshwater as well as marine) occurring in the eel's area, augmented with animals living out of water, e.g. worms (Ref. 172). Best temperature for making eels sexually mature is 20-25°C (Ref. 35388). Sensitive to weak magnetic fields (Ref. 89141, 89142). Their high fat content and benthic feeding habits in continental waters make them vulnerable to the bioaccumulation of pollutants, such as heavy metals and organic contaminants, that may result in organ damage and impaired migration capability (Ref. 82710) and lowered genetic variability (Ref. 82711). Review of information supports the view that the European eel population as a whole has declined in most areas, the stock is outside safe biological limits and current fisheries not sustainable (Ref. 82712). Obvious decreasing of the stocks for all the continental native distribution area (Ref. 40476). Utilized fresh, dried or salted, smoked and frozen; can be fried, boiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 The common eel is long and snake-like in shape with a tough, slimy skin. The dorsal fin starts on the back some way behind the gill slits and small pectoral fins and runs the length of the body. At the tail the dorsal fin merges with the ventral fin, that runs along the underside of the body. The eel can be black, brown or dark olive green in colour above, paler and yellowish on the underside. Sexually maturing eels become silver rather than yellow.Anguilla anguilla has a complex life history that is poorly understood. It involves migration of mature adults from European rivers and estuaries to the Sargasso Sea in the west Atlantic for spawning, and the subsequent return of juveniles. They metamorphose twice, part of the life cycle spent in fresh water and part in estuarine or full sea water (Whitehead et al., 1986). The adult eels and the returning juveniles (elvers) are commercially fished. The common eel has small eyes and its lower jaw projects from the upper, which distinguishes it from the conger eel, Conger conger. In the common eel the dorsal fin arises about a head's length behind the gill slits and pectoral fins while in the conger eel the fin arises further forward, from just behind the pectoral fins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Rivers of North Atlantic, Baltic and Mediterranean seas. Continuous introductions to Asia and South and Central America, but not reproducing. Spawning area in western Atlantic (Sargasso Sea). Also distributed along the coast of Europe from the Black Sea to the White Sea
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The geographic range of adult European eels includes the English Channel and coasts of the Mediterranean Sea and northern Atlantic Ocean from Iceland to Mauritania (Ringuet et al., 2002). Their range also encompasses the Baltic and North Seas, as well as all accessible continental or coastal hydrosystems (Ringuet et al., 2002). In the early spring months, European eels migrate to the Sargasso sea for breeding. Larvae are hatched from the Sargasso Sea and can also be found along the coast of Europe. Silver (juvenile) stage eels of Anguilla anguilla live in tributaries along the European coast.

Biogeographic Regions: palearctic (Native ); atlantic ocean (Native ); mediterranean sea (Native )

  • Ringuet, S., F. Muto, C. Raymakers. 2002. Eels: Their Harvest and Trade in Europe and Asia. Traffic Bulletin, 19/2: 2-27.
  • Tsukamoto, K., I. Nakai, W. Tesch. 1998. Do all freshwater eels migrate?. Nature, 396: 635-636.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Anguilla anguilla has been shown to be distributed from North Cape in Northern Norway, southwards along the coast of Europe, all coasts of the Mediterranean and on the North African Coast (Schmidt 1909, Dekker 2003). It very rarely enters the White and Barents seas, but it has been recorded eastward to the Pechora River in northwest Russia. The species occurs in low abundance in the Black Sea where it migrates east to the Kuban drainage (occasional individuals reach the Volga drainage through canals), in northern Scandinavia and eastern Europe. A report by the ICES Study Group on Anguillid Eels in Saline Waters (SGAESAW) indicates that eel populations typically contain a mix of freshwater residents, saline water residents, and inter‐habitat migrants (ICES/SGAESAW 2009). It also widely occurs in most inland waters of Europe (e.g. lakes). It is thought that the continental distribution of the European Eel is over an area of approximately 90,000 km² in Europe and parts of North Africa (Moriarty and Dekker 1997), with a substantially larger range if their marine distribution is considered. For example, in England and Wales, there are thought to be a total of 2,694 km² of transitional waters, which account for approximately 68% of the potential eel producing habitat across all 11 River Basin Districts (Defra 2010).

For several decades prior to an EU-wide ban on export in 2010, A. anguilla was also exported to Asia for seed stock in eel farms (Ringuet et al. 2002). This species may well have been introduced in some parts of Asia (through escape or release from farms), however these are not thought to contribute to the population and therefore areas of introduction have been excluded in the range information. Anguilla anguilla are thought to spawn in the Sargasso Sea in the West Central Atlantic between late winter and early spring, before eggs hatch and leptocephalus larvae migrate back across the Atlantic to begin the continental phase of their life history (Schmidt 1912, Aarestrup et al. 2009).


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic Ocean: Atlantic coast from Scandinavia to Morocco; Baltic, Black and Mediterranean Seas; rivers of North Atlantic, Baltic and Mediterranean seas (Ref. 172, Ref. 51442). Continuous introductions to Asia and South and Central America. Spawning area in western Atlantic (Sargasso Sea). At least one country reports adverse ecological impact after introduction. Recent genomic DNA studies show that the European eel exhibits isolation by distance, implying that non-random mating and restricted gene flow among eels from different location exists (Ref. 43723). The existence of 3 genetically distinct sub-populations is suggested: a Northern European subpopulation (consisting mainly of the Icelandic stocks); a Western European subpopulation (including the Baltic, the Mediterranean and Black Sea); a Southern sub-population (including stocks of Morocco) (Ref. 43723, 89139). International trade restricted (CITES Appendix II, since 13.5.2009).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western and Eastern Atlantic, Baltic Sea, North Sea, Mediterranean Sea, Black Sea, Sea of Marmara: European seas and adjacent watersheds, spawing and larval migration routes to and from the western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in the rivers of the North Atlantic, Baltic and Mediterranean Seas; it also occurs along European coasts from the Black Sea to the White Sea in Russia. Spawning takes place in the Sargasso Sea in the western Atlantic (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The appearance of European eels varies greatly depending on life stage. As leptocephali, European eels are small, leaflike, and transparent (Deelder, 1970). After metamorphosing into the silver stage, European eels appear silvery in color with elongated dorsal and anal fins that are continuous with the caudal fin (Deelder, 1970). European eels lack pelvic fins (Deelder, 1970). Upon full sexual maturation, European eels develop enlarged eyes, lose their ability to feed, and turn green, yellow or brownish in color (Van Ginniken and Thillhart, 2000).

Female eels are generally substantially larger than males. The largest recorded mass of a female eel is 6.599 g (Dekker, van Os and van Willigen, 1998). The maximum published length of a European eel was 133 cm.

Range mass: 6,599 (high) g.

Range length: 133 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Deelder, C. 1970. Synopsis of biological data of the eel Anguilla anguilla (Linnaeus, 1758). FAO Fish. Synop., 80: 68.
  • Dekker, W., B. van Os, J. van Willigen. 1998. Minimal and maximal size of eel.. L'ANGUILLE EUROPENNE. 10E REUNION DU GROUPE DE TRAVAIL "ANGUILLE" EIFAC/ICES..
  • Van Ginneken, V., G. Van Den Thillart. 2000. Physiology: Eel fat stores are enough to reach the Sargasso. Nature, 403: 156-157.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Analspines: 0; Vertebrae: 110 - 120
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 3506)); 133 cm TL (female); max. published weight: 6,599 g (Ref. 39903); max. published weight: 2,850.0 g; max. reported age: 88 years (Ref. 72468)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Elongated, anguilliform body (Ref. 51442), cylindrical anteriorly, somewhat compressed posteriorly (Ref. 6125). Lower jaw slightly longer and projecting (Ref. 6125, Ref. 51442). Gill openings small and vertical, restricted to the sides (Ref. 6125). Elongated dorsal and anal fins, confluent with caudal fin (Ref. 6125, Ref. 51442), forming one unique fin from the anus to the middle of the back with minimum 500 soft rays (Ref. 40476). Dorsal fin origin far behind pectoral fins; anal fin origin slightly behind anus, well back from origin of dorsal fin (Ref. 6125). Pelvic fins absent (Ref. 2196, Ref. 51442). Greenbrown colored (Ref. 51442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

benthic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters.Spawning occurs in Sargasso Sea, leptocephali drift for about 3 years across Atlantic to brackish waters, after several years, return migration back to Sargasso Sea.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depending on the lifestage of the individual eel, European eels can be found in marine, freshwater, and brackish aquatic environments. Typically, the European eel is found in depths of 0-700 m, most often on the floor of the ocean or river in which it is living.

Range depth: 0 to 700 m.

Habitat Regions: saltwater or marine ; freshwater

Aquatic Biomes: benthic ; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

Habitat:
The species is found in a range of habitats from small streams to large rivers and lakes, and in estuaries, lagoons and coastal waters. Under natural conditions, it only occurs in water bodies that are connected to the sea; it is stocked elsewhere.

Ecology:
The species is facultatively catadromous, living in fresh, brackish and coastal waters but migrating to pelagic marine waters to breed. While there is some understanding of the eel’s continental life history, relatively little is known about its marine phase. The migrations in the European Eel’s life cycle are the longest and most oceanographically complex of the anguillid species (Tsukamoto et al. 2002). There are a number of phases in an eel’s life that have specific terminology; the leaf-shaped marine larval stage is referred to as leptocephalus; these become glass eels as they reach brackish water, before developing into the pigmented, growth phase: the yellow eel. The final stage is the marine-migratory silver eel which is characterised by silvery counter-shading and large eyes.

There are no exact data about specific spawning sites, however, it is proposed that spawning takes place in an elliptic zone, about 2,000 km wide in the Sargasso Sea, in the West Central Atlantic (about 26°N 60°W). Survey catches of leptocephalus larvae suggest that spawning peaks at the beginning of March continuing through until July (McCleave 1993). The adults are assumed to die after spawning. Oceanic migration of leptocephali is estimated to take about two years on average before they arrive at the continental shelf (Bonhommeau et al. 2008, Zenimoto et al. 2011). The mechanisms by which leptocephali reach the European and N. African coasts are also not well understood. The main migrations occur in late-autumn to early-spring in Iberian and Bay of Biscay waters, and they are delayed in more northerly sites until temperatures rise in the spring. By the time the leptocephali reach the continental slope they are as large as 100 mm in size and metamorphose into glass eels which are elongate and have a transparent body. These glass eels are observed in the summer and autumn on Portuguese coasts, and in winter and spring in the North Sea.

Glass eels enter freshwater as sexually undifferentiated individuals. Development and differentiation of the sexual organs are thought to be closely correlated with body size and associated with the yellowing phase of the eels life history. Sex determination is principally driven by environmental factors with density dependence producing more males at high densities (Davey and Jellyman 2005). Male European Eels initially grow faster than females, however, females achieve a greater age and size than males when sexually mature. Furthermore, the mean length increases significantly with latitude in females but not males, whereas age increases significantly in both (Durif et al. 2009, M. Aprahamian unpub. data). Male fitness is maximised by maturing at the smallest size that allows a successful spawning migration (a time minimising strategy) such that males tend to emigrate at a length of <450 mm. Conversely, females adopt a more flexible size-maximising strategy prior to migration that trades off pre-reproductive mortality against fecundity (Davey and Jellyman 2005). There is considerable geographic variation in mean length at metamorphosis of male and female European Eels (Vøllestad 1992). Dekker et al. (1998) produced a paper describing the extreme sizes in each of the life stages of the European Eel from data at a long term capture locality in the Netherlands (Sizes (cm): Min – Max, Glass eels: 5.4 – 9.2, Yellow: 6.9 – 133.0, Silver (M): 21.2 – 44.4, Silver (F): 26.4 – 101.0). Driven by density dependence, there are often skewed sex ratios at individual localities as well as geographic bias associated with latitude.

Eel growth increases with temperature and growth rate is generally faster in saline water than fresh. Furthermore those individuals produced in saline waters usually contain lower loads of the swim bladder parasite, Anguillicola crassus and thus may have improved chances of reaching their spawning grounds (ICES/SGAESAW 2009). During maturation, dependent on size, European Eels feed off a variety of organisms including fish, amphipods and decapod crustaceans. In saline muddy-bottomed habitats eels forage on bivalves, shrimp and polychaete worms.

The age at which silver eels mature and undertake their spawning migration is hugely variable and dependent on latitude and temperature of the environment in which they have grown, physical barriers that block migration routes, growth rate and sex differences. From the data available, lower bound estimates for average length of the continental growth phase are approximately 3-8 years for males and 4-5 years for females and upper bound estimates approximately 12-15 years for males and 18-20 for females (Acou et al. 2003, Froese and Pauly 2005, Durif et al. 2009). Assessment of available data on generation length during the IUCN Red List process highlighted that defining a single figure for species such as eels was extremely difficult. Factors that can significantly affect this parameter include longitude and latitude, sex and habitat quality. Fifteen years was agreed upon after this analysis and it is important to indicate that this is inclusive of an estimated two year larval migration and 0.5 year spawning migration of silver eels.


Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 700 m (Ref. 54218)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9725 specimens in 2 taxa.
Water temperature and chemistry ranges based on 210 samples.

Environmental ranges
  Depth range (m): -9 - 615
  Temperature range (°C): 3.141 - 21.403
  Nitrate (umol/L): 0.194 - 17.847
  Salinity (PPS): 6.114 - 38.613
  Oxygen (ml/l): 2.113 - 8.276
  Phosphate (umol/l): 0.035 - 1.740
  Silicate (umol/l): 0.885 - 50.947

Graphical representation

Depth range (m): -9 - 615

Temperature range (°C): 3.141 - 21.403

Nitrate (umol/L): 0.194 - 17.847

Salinity (PPS): 6.114 - 38.613

Oxygen (ml/l): 2.113 - 8.276

Phosphate (umol/l): 0.035 - 1.740

Silicate (umol/l): 0.885 - 50.947
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The adult eel is most abundant in estuaries and low salinity pools but is also found around the coast in permanent tide pools, on the lower shore and shallow sublittoral. Being nocturnal it is inactive during the day under rocks or weed or in soft sediments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Part of the common eel's life cycle is spent in the sea, and part in freshwater rivers. It is often common on the shore (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

European eels have completely different diets during different life stages. No food contents have ever been discovered in the guts of leptocephali, therefore their diet is unknown (Fisheries Global Information System, 2005). Glass eels consume insect larvae, dead fish, and small crustaceans (Sinha and Jones, 1975). Adult eels have a fairly broad diet and eat freshwater, marine, or terrestrial fauna. Their primary food source is aquatic invertebrates, but they will eat essentially any food they can find-- even dead organisms (Sinha and Jones, 1975). European eels are reported to leap out of the water during the winter and feed on terrestrial invertebrates (Deedler, 1970).

Animal Foods: fish; eggs; carrion ; insects; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; zooplankton

Other Foods: detritus

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates, Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Observations have shown that scent and taste appear to be more important than sight for foraging purposes (Ref. 172). Smaller individuals feed mainly on insect larvae, molluscs, worms, and crustaceans; subadults on benthic invertebrates and fish (Ref. 51442); larger individuals on other fishes. This species can also be a scavenger, feeding on carcasses. Yellow and silver eels are nocturnal and opportunistic feeding on virtually all small animals they encounter. Cannibalism occurs amongst yellow eels (Ref. 172). Feeding ceases when silver eels start their spawning migration and rely on their lipid reserves for energy. Leptocephali feed on gelatinous zooplankton (e.g. Hydrozoa, Thaliacea and Ctenophora) (Ref. 89143).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

European eels are both a food source and a predator of organisms in their ecosystem. They are consumed by birds and large predatory fish (Deelder, 1970). European eels also act as a host for the nematode Aguillicola crassus which infects the swim bladders of European eels (Deelder, 1970). European eels distribute nutrients between marine and freshwater ecosystems because they migrate between those habitats (Deelder, 1970).

Commensal/Parasitic Species:

  • Anguillicola crassus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European eels are preyed upon by larger eels and other fish and fish-consuming birds, such as cormorants (Phalacrocorax) and herons (Ardeidae) (Deelder, 1970). One defense mechanism employed by eels is that they hide under rocks and burrow in the sand, thus avoiding their predators. The coloring of eels at various life stagies (i.e. the transparency of leptocephali, the dark grey to green color of adults, etc.) also serves as camouflage.

Known Predators:

  • herons (Ardeidae)
  • cormorants (Phalacrocoracidae)
  • predatory fish (Actinopterygii)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus lucii endoparasitises anterior intestine of Anguilla anguilla

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Anguilla anguilla

Animal / parasite / ectoparasite
Ergasilus gibbus ectoparasitises gill of Anguilla anguilla

Animal / parasite / endoparasite
Trypanosoma granulosum endoparasitises blood of Anguilla anguilla
Other: sole host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Anguilla anguilla (Anguilla anguilla eel) is prey of:
Lutra lutra
Phalacrocorax carbo
Ardea cinerea
Sterna paradisaea
Platichthys flesus
Podocotyle staffordi
Derogenes varicus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Anguilla anguilla (Anguilla anguilla eel) preys on:
Tanypus punctipennis
Blicca bjorkna
Acerina cernua
Crangon crangon
Nereis diversicolor
Neomysis integer
Corophium volutator
Gammarus
Jaera albifrons

Based on studies in:
Austria, Neusiedler Lake (Lake or pond)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Worm Cataract. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vibriosis of eel (acute). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vibriosis Disease (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Triaenophorus Disease (juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Streptococcal Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skin Fungi (Saprolegnia sp.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pseudodactylogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pomphorhynchus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Podocotyle Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pleistophora disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neoechinorhynchus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Intestinal Ligulosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gyrodactylogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Glugea. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Flexibacter Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diphyllobothrium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Camallanus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Branchiomyces Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anguillicola Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchor worm Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on freshwater and marine fauna
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European eels sense the environment using their sense of taste. They have been shown to locate necessary amino acids via chemotaxis (Sola and Tongiorgi, 1998). European eels also utilize olfaction, most probably for homing purposes. There is little if any documentation of social communication between eels (Deelder, 1970).

Perception Channels: visual ; tactile ; chemical

  • Sola, C., P. Tongiorgi. 1998. Behavioural responses of glass eels of Anguilla anguilla to non-protein amino acids. Journal of Fish Biology, 53/6: 1253.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

European eels begin their life cycle as eggs on the bottom of the Sargasso Sea. They hatch as leptocephali, leaf-like larvae (Tsukamoto, Nakai and Tesch, 1998). After hatching, larvae spend a maximum of one year migrating to Europe, or occasionally North America, via ocean currents. The larvae will then metamorphose into 'glass eels,' the next stage of the life cycle, and enter estuarine areas. Male glass eels contineu to grow for approximately 6 to 12 years; females for 9 to 20 years (Deelder, 1970). After a final metamorphosis, European eels migrate back to the Sargasso Sea to spawn.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Catadromous species. When sexual maturity is reached they leave the river. Spawning migrations occur mainly during the second half of the year but have been observed year-round, usually commencing during dark nights (Ref. 172). Maturity is obtained during the spawning migration (Ref. 88171). Actual spawning has never been observed but is believed to occur solely in the Sargasso Sea between March and June (Ref. 89144). After spawning (at 600 m depth) adults die. Sigmund Freud described the testicles of eel (Ref. 72449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The lifespan of European eels is dependent on maturation time because once eels mature and spawn, they die. European eels can spawn as early as 7 years old. The maximum reported age of a European eel in the wild is 85 years (Dekker, van Os and van Willigen, 1998).

Range lifespan

Status: wild:
85 (high) years.

Typical lifespan

Status: wild:
7 (low) years.

Average lifespan

Status: captivity:
55.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 88 years (captivity) Observations: In the wild, these semelparous animals die after first spawning. After transformation from juvenile to adult stage they do not eat and feature elevated corticosteroids while they migrate to the Sargasso Sea to spawn. Preventing migration by keeping animals in captivity significantly extends lifespan. One female called "Putte", generally assumed to be a European eel, died at Halsinborgs Museum in Sweden at about 88 years of age (Caleb Finch 1990). In the wild, animals do not commonly live more than 10-15 years, though it is possible some live up to 30 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Upon reaching sexual maturity, European eels migrate from freshwater streams back to the Sargasso Sea in order to spawn and die in the late winter months to the early summer months. European eel males release sperm into the water in which female European eels have already laid eggs, thereby fertilizing the eggs (Horie et al., 2004). Very little is known about the actual spawning mechanism, and time to hatching is variable.

Mating System: polygynandrous (promiscuous)

European eels spawn during the late winter to early spring months. There is little information on their reproduction, but since European eels are closely related to Japanese eels, Anguilla japonica, similar breeding patterns might be assumed. Female A. japonica can lay from 2,000,000 to 10,000,000 eggs, but die soon after spawning (Deelder, 1970). Eel larvae are independent from time of birth until time of death.

Breeding interval: European eels breed only once during their lifetime. Once spawning is complete, European eels die .

Breeding season: European eels spawn in late winter to early spring.

Range number of offspring: 2,000,000 to 10,000,000.

Range age at sexual or reproductive maturity (female): 9 to 20 years.

Range age at sexual or reproductive maturity (male): 6 to 12 years.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

European eels invest a substantial amount of energy in reproduction, and die shortly thereafter (Deelder, 1970). Consequently, the only resource that female eels give to their offspring is enough food source to last the egg until hatching. After hatching, the larvae are completely independent and able to find food (Lecomte-Finiger, 1994).

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

  • Deelder, C. 1970. Synopsis of biological data of the eel Anguilla anguilla (Linnaeus, 1758). FAO Fish. Synop., 80: 68.
  • Lecomte-Finiger, R. 1994. The Early Life of the European Eel. Nature, 370: 424-425.
  • Okamura, A., H. Zhang, T. Utoh, A. Akazawa, Y. Yamada, N. Horie, N. Mikawa, S. Tanaka, H. Oka. 2004. Artificial hybrid between Anguilla anguilla and A. japonica. Journal of Fish Biology, 64/5: 1450.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Senses help navigate during migration: European eel
 

European eels navigate during long migrations by being sensitive to many different types of stimuli.

   
  "Those specimens that do complete their life cycle use many environmental cues to navigate during their migration. Not only are eels highly sensitive to olfactory stimuli, they also respond readily to small fluctuations in water movements, seismic activity, and even to the minute electrical fields generated by water currents." (Shuker 2001:74-75)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla anguilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTCGTATTTGGTGCCTGAGCCGGAATAGTCGGCACTGCACTGAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGATTTGGCAACTGACTTGTGCCATTAATAATCGGCGCCCCAGACATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTTTACCCCCATCATTTCTTCTACTACTAGCCTCCTCTGGAGTAGAGGCCGGAGCTGGTACAGGCTGAACTGTATATCCACCCCTGGCTGGAAACTTAGCCCACGCTGGGGCATCTGTTGACCTGACAATTTTCTCACTCCACCTTGCAGGTATTTCATCAATTCTAGGGGCCATTAACTTTATTACTACAATTATTAACATGAAACCGCCTGCAATTACACAGTACCAAACTCCCCTGTTTGTATGAGCTGTATTAGTAACCGCCGTTTTACTACTCCTCTCCCTGCCAGTCCTAGCCGCAGGCATTACAATACTTCTGACTGACCGAAATCTAAATACGACCTTCTTTGATCCTGCAGGGGGTGGAGACCCAATCCTCTACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACATATTGTTGCTTATTATTCCGGAAAGAAAGAACCATTTGGCTATATAGGAATAGTCTGAGCAATGATGGCCATCGGACTACTAGGATTCATCGTATGAGCACACCATATGTTTACGGTCGGAATAGACGTAGACACTCGTGCTTACTTCACTTCCGCCACAATAATTATCGCAATTCCAACTGGGGTAAAAGTATTCAGCTGACTAGCCACATTACATGGAGGCGTTATCAAATGAGAAACCCCACTTCTTTGAGCTTTAGGTTTTATTTTCCTATTCACAGTTGGAGGCCTAACAGGCATTGTTCTAGCAAACTCATCAATCGACATTGTATTACATGATACATACTATGTAGTAGCCCACTTCCATTATGTTCTGTCCATAGGGGCAGTATTTGCTATTATGGGAGGCTTTGTACACTGATTCCCCTTATTTTCAGGCTATACACTACACGACACATGAACCAAAGTACACTTTGGGATTATGTTCGTAGGGGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGCTTAGCAGGAATACCACGGCGTTACTCAGATTACCCAGATGCCTATACCCTATGAAATACAATCTCCTCTATCGGATCCCTAATTTCTCTCACAGCCGTAGTCCTATTCCTATTTATCCTATGAGAAGCATTTACTGCTAAACGAGAGGTAAAATGAGTAGAACTTACAGAAACAAATGTTGAATGACTACATGGATGTCCTCCACCATATCACACATTCGAAGAACCAGCATACGTCCGAGTTCAACCCCCATCAGATGATAAAAAATCAGAAGCCAAAGCCCATATTCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla anguilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

European eel populations are not currently threatened.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2014

Assessor/s
Jacoby, D. & Gollock, M.

Reviewer/s
Beaulaton, L., Belpaire, C., Dekker, W., Diaz, E., Durif, C., Freyhof, J., Knights, B., Turnock, S. & Wickström, H.

Contributor/s
Ahn, H., Bennett, L., Casselman, J., Crook, V., DeLucia, M., Kaifu, k., Kottelat, M., Kurwie, T., Sasal, P., Silfvergrip, A., Uchida, K. & Walker, M

Justification

Anguilla anguilla exhibits facultative catadromy, has multiple life stages, and is semelparous and panmictic; these life history traits made application of the IUCN Red List criteria more challenging. Anguillids are often referred to as ‘freshwater eels’, however, it is known that they can exhibit inter-habitat migration and that a proportion may stay in estuaries, lagoons and coastal waters, rarely, if ever, entering freshwater: this element of the population is particularly poorly understood.

Ideally, the IUCN Red List criteria would be applied to mature eels at their spawning grounds, and in the absence of such data, the criteria would be applied to silver eels starting their spawning migration (in the case of European Eels, leaving ‘continental’ waters), as these represent the maximum estimate of spawning stock biomass, but data sets for this are very rare. The majority of available data relates to glass eels and yellow eels but the relationships between recruitment, yellow eel populations, silver eel escapement, and spawner stock biomass are poorly understood. As such, the IUCN Red List criteria have to be applied to an amalgamation of multiple life stages, which may not exactly mirror the mature spawning stock but can be used as the current best estimate. Finally, the European Eel is a panmictic species, i.e. they come from one spawning stock. Taken literally, this assumes equal importance of the continental populations, and as such escapement from a specific river/country/region is not equivalent to the subsequent recruitment as this relies on the spawning stock as a whole, irrespective of escapement location. However, there are hypotheses that certain regions may have greater importance for the spawning stock, e.g. males primarily escaping from North Africa (Kettle et al. 2011), and as data are only available from certain parts of the species' range - data are particularly sparse for Mediterranean and North African populations - it is important that conservation initiatives and management actions are adjusted as new data become available.

In relation to A. anguilla, only a very small amount of data are available for silver eels, and while this is not geographically representative of the stock as a whole, a cursory analysis of this alone indicates that the mean decline in silver eel escapement is estimated to be 50-60% over the period of three generations (45 years), just placing them in the Endangered category. There is a similar dearth and uneven geographical spread in the data that relates to yellow eels; however, taking these limitations into account, analysis indicates that there has been a slightly greater decline in this life stage compared to silver eels. Compounding these declines in escapement of maturing eels, according to the available data, there has been substantial declines (90-95%) in recruitment of the European Eel across wide areas of its geographic range during the period of the last 45 years (or three generations) due to a range of threats facing freshwater eels at multiple life history stages. Recruitment has fluctuated during the last century. However, the analysis carried out as part of the IUCN Red List assessment mirrors the WGEEL recruitment index (five year average) which, despite increases in recruitment during the last few years, is currently at its lowest historical level of 1-10% the recruitment of the 1980s, (ICES WGEEL 2013). Further, there is concern that due to the period of time eels spend feeding and growing, prior to silvering and migrating to spawn, that silver eels may continue to decline, even if recruitment is showing recovery.

There is a suite of threats that have been implicated in causing the decline in European Eel recruitment and stocks: barriers to migration – including damage by hydropower turbines; poor body condition; climate change and/or changes in oceanic currents; disease and parasites (particularly Anguillicola crassus); exploitation and trade of glass, yellow and silver eels; changing hydrology; habitat loss; pollutants; and predation. The impact of these threats individually or synergistically, are likely regionally specific; however, more broadly, climate and ocean currents have been suggested to play an important role in the survival and transport of the leptocephalus larvae and recruitment of glass eels to coastal, brackish and freshwater habitat. Further research is required to fully understand the complexities of this particular aspect of the eel's life history but there are conflicting opinions as to the degree, if any, which oceanic factors contribute to broad fluctuations in eel numbers.

Eel Management Plans (EMPs) have been developed in European countries since 2007 as a stipulation of the EU Council Regulation No 1100/2007 relating to the recovery of the European Eel. Currently, more than 50% of the 81 EMP progress reports across Europe are failing to meet their target silver eel biomass escapement of 40% in accordance with the regulation, indicating that more work is required (WKEPEMP 2013). Further, international regulation was enforced for this species in 2007 when CITES (the Convention on International Trade in Endangered Species of Wild Fauna and Flora) listed A. anguilla on Appendix II (this came into force in March 2009). Since this time, exports outside of Europe have been banned due to concern over the decline in recruitment and stocks, however, trade continues within the EU and from non-EU countries within its range to other non-EU countries.

A number of management measures are being implemented in line with EMPs, for example easing of barriers. The influence of these measures, however, will take time to determine as they have only very recently been implemented and very much focus on the freshwater component of the eel's life-history. Arguably the most widely practised measure is restocking; however, there remains a great deal of debate as to whether this benefits eel spawning stocks and thus enhanced future recruitment. Measures that apply to silver eels, such as fisheries management, and/or trap and transport programmes, can theoretically have an almost immediate effect on the potential spawning stock, although when carried out in isolation, their benefit is significantly reduced.

As stated above, the relationship between life-stages is poorly understood, but it was generally agreed that it is very likely that the low recruitment will ultimately translate, though not linearly, to reduced future escapement for, at best, one generation length (15 years). Further, low recruitment has been proposed to be indicative of low historical breeding stock due to the relatively short time period (~2 years) between spawning and subsequent glass eel abundance. As such it was deemed appropriate to assign A. anguilla a Critically Endangered listing under current observations and future projected reductions of mature individuals (A2bd+4bd).

While this status is unchanged from the previous assessment, it is important to highlight that the process of this designation was very different in that it was carried out as part of an anguillid specific workshop, and that new data were incorporated – for example the generation length was reduced. There was general agreement that the situation had improved, albeit slightly, for this species both as far as recruitment and implementation of management measures was concerned. As such it is imperative to highlight that this listing is borderline, and that if the recently observed increase in recruitment continues, management actions relating to anthropogenic threats prove effective, and/or there are positive effects of natural influences on the various life stages of this species, a listing of Endangered would be achievable. Further, a drive to fill data gaps – particular in relation to the southern range of this species – would allow an even more robust assessment, and we strongly recommend an update of the status in five years.

Assessment of this species was carried out during a workshop held at the Zoological Society of London from July 1st-5th, 2013.


History
  • 2010
    Critically Endangered
  • 2006
    Not Evaluated
    (IUCN 2006)
  • 2006
    Not Evaluated
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

A subset of the recruitment index data in the ICES WGEEL 2012 report was used for analysis i.e., data collected as part of fisheries independent scientific monitoring or fisheries dependent data with an associated metric of effort (e.g. catch per unit effort (CPUE)). Other data were kindly provided by Dr Brian Knights, and this was included as part of the assessment process. Catch effort can be variable in fishing data, and under-reporting and, in some cases, an absence of reporting of landings is a serious problem in most European countries. Thus landings data cannot be accepted as a precise measure of stock status. However, trends in the reported catch data will, to some extent, reflect true changes in fishing yields. All the data were analysed to assess trends in recruitment, population and spawner escapement; however, it was primarily used to guide discussions that resulted in the broad agreement of the Critically Endangered listing by the assessment team, which was in turn supported by the majority of reviewers.

There are more data available for A. anguilla in northern, central and southern European countries compared to North Africa, however there is considerably less freshwater habitat available to the European Eel in this part of its range. For analytical purposes the North Sea subpopulation is often referred to in separate terms to the rest of Europe by ICES. This is because the decline in abundance of A. anguilla has been shown to be substantially greater for this area compared to anywhere else (ICES WGEEL 2012), although this declining trend can be mostly accounted for during the period between 1980 and 1985.

Determining changes in the international stock in anguillid eels is difficult due to limited data and the poor understanding of the relationship between recruitment, freshwater populations, and escapement. Not only is there a huge time lag between the recruitment of glass eels to fresh and brackish water and the subsequent escapement of silver eels, but given that A. anguilla are panmictic, escapement from one area does not translate directly into returning larval recruitment at the same locality. Indeed for all intents and purposes it is assumed that practically nothing is known about the dynamics of the oceanic phase of A. anguilla (ICES WGEEL 2013). It has been proposed that due to the relatively short time-span between spawning and recruitment that the latter is a good indicator of the past spawning stock that produced the juvenile cohort; this will depend, to an extent, on the significance of oceanic factors on larval transport.

Assessment of these datasets using the IUCN Red List Categories and Criteria took into account, where this information was available, consistency of sampling; longevity of the data set; whether they were eel-specific or multi-species; whether the collection methods were active or passive; whether the watershed the data related to was subject to restocking activity; and/or whether, in the case of fisheries independent data, there was exploitation in the region.


Glass and Yellow Eel Recruitment:
The glass eel data sets used in the analyses for this IUCN Red List assessment were from The Netherlands, Sweden, Ireland, France, and Spain. The elver data sets used were from Norway, Sweden, Ireland and Denmark. These data sets were a mix of fisheries CPUE and scientific surveys and as many were drawn from the WGEEL 2012 report it is unsurprising that they reflect the findings of this document, and they are discussed in this context below.

Since the early 1980s, a steady and almost continent wide decline of ~90% has been observed in the recruitment of glass eels. Recently, the WGEEL recruitment index (five year average) fell to its lowest historical level: less than 1% for the North Sea and 5% elsewhere in the distribution area with respect to recruitment from between 1960–1979 (ICES WGEEL 2012). In the last two years however, the recruitment index has increased to 1.5% of the 1960–1979 reference level in the ‘North Sea’ series, and to 10% in the ‘Elsewhere’ series, but both remain far from ‘healthy’ (ICES WGEEL 2013). This could possibly be in response to the closure of silver eel fisheries across Europe in 2009, although this increase is within the natural variation of historical records (ICES WGEEL 2012). Whilst data from catch returns indicate this increase in recruitment, the impact of the overall decline will likely continue to influence adult stock for at least one generation length (ICES WGEEL 2012). Furthermore, the use of fisheries data makes it difficult to assess the full extent of this recent increase in recruitment due to a lack of effort metrics for some data sets and the introduction of quotas which, once reached and fishing ceases, provide no way of estimating subsequent arrivals to coastal freshwater habitat.

Yellow Eel:
Data sets used to assess yellow eel populations were from Sweden, Norway, Ireland, the UK, the Netherlands and France and were a mix of scientific fishing surveys, electrofishing and fisheries. It was raised that some of the Swedish sites may have exhibited less pronounced declines, and in some cases even increases in population, due to stocking (Wickström 1983, Neuman et al. 1990, Andersson et al. 2012).

While the decline in yellow eel populations was not as severe as that of recruitment, the available data indicated that it was greater than 50% over three generations (45 years). It is very likely that the less pronounced decline will be partially due to density dependent mortality (Svedäng 1999). However, it needs to be taken into account that the age range of yellow eels is broad and that there may very well be a time lag in knock-on population effects. As such, any increase in recruitment would not be expected to be immediately mirrored in a rise in yellow eel numbers, indeed, it is possible that this life stage may continue to decline.

Silver Eels:
The data sets on silver eel escapement were from France, Norway, Ireland and Sweden and were collected from scientific surveys and fisheries.

Silver eel decline was not as pronounced as yellow eel populations or recruitment but, similar to yellow eels, the indication was that the decline across the range was greater than 50% over three generations. Again, this may be due to density dependent mortality at previous life stages, but it cannot be ruled out that a decline in silver eel escapement may continue despite increases in glass eels and/or yellow eels due to the long generation time.

The EU regulation 1100/2007 – article 2.4 states “The objective of each [EU] Eel Management Plan shall be to reduce anthropogenic mortalities so as to permit with high probability the escapement to the sea of at least 40 % of the silver eel biomass relative to the best estimate of escapement that would have existed if no anthropogenic influences had impacted the stock”. According to the ICES WKEPEMP report, assigned to evaluate the current progress of the Europe-wide EMPs, out of 81 eel management units (EMUs), 17 EMU are reported as achieving their biomass targets, 42 are not and 22 did not report (WKEPEMP 2013). In southern Norway, sharp declines in abundance have been observed since 2000 after relatively long periods of stability (ICES WGEEL 2012).

Anguilla anguilla has been included in a number of regional and national Red List assessments in Europe over the past 10 years. The European Eel has been assessed as Critically Endangered across Europe (Freyhof and Brooks 2011) as well as in Sweden (Gärdenfors 2005), Denmark (NERI 2009), France (UICN 2010) Norway (Kålås et al. 2010), and Ireland (King et al. 2011) and in regional assessments for the Baltic Sea area (HELCOM 2007) and north Belgium (Verreycken et al. 2013). Indeed the European Eel showed the largest negative population trend of any of the freshwater fishes (-75%) in the Belgian report (Verreycken et al. 2013).

For the North African range of the population there is considerably less information. A regional Red List assessment in North Africa suggests that A. anguilla is Endangered due to a decline in recruitment of 50% in the last 10 years with annual catches declining by between 10 and 25% since the 1980s, and by more in Tunisia alone (Azeroual 2010).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

The causes of the declining recruitment rates are still not fully understood (Dekker 2007), and while there are many hypotheses, the significance of any single threat, or the synergy it may have with other threats is still poorly understood. It is important to highlight, however, that management measures focusing on a single threat, in isolation of other identified pressures (listed below), are less likely to have a significant positive effects on eel numbers. The assessment process and accompanying external review indicated that a comprehensive discussion of these threats and their impacts was significantly beyond the scope of this assessment – there is a significant body of information including a great deal of contradiction in peer-reviewed and grey literature, and in expert opinion relating to these threats. Below we list (in alphabetical order) suspected threats with some (but not all) key references and a very brief synopsis of these threats – this is by no means comprehensive and does not attempt to fully dissect the wide range of views and data on these pressures. As such, a robust and comprehensive analysis of the existing data and opinion on factors linked to decline in abundance of the European Eel would be extremely timely.

Barriers to migration – including damage by hydropower turbines - Winter et al. 2006, Acou et al. 2008, Azeroual 2010, van der Meer 2012.

Body condition - Boëtius and Boëtius 1980, Svedäng and Wickström 1997, van Ginneken and van den Thillart 2000.

Climate change and/or changes in oceanic currents (including the influence of the North Atlantic Oscillation (NAO)) - Castonguay et al. 1994, Dekker 2004, Kim et al. 2004, Minegishi et al. 2005, Bonhommeau et al. 2008, Miller et al. 2009, Durif et al. 2011, Pacariz et al. 2013.

Disease and parasites (particularly Anguillicola crassus) - De Charleroy et al 1990, Würtz and Taraschewski 2000, Vettier et al. 2003, van Ginneken et al. 2004, Gollock et al. 2005, Palstra et al. 2007, Sjöberg et al. 2009, Haenen et al. 2012.

Exploitation and trade of glass, yellow and silver eels - ICES WGEEL 2012, 2013; Crook 2010; Crook and Nakamura 2013.

Hydrology – e.g. Kettle et al. 2011.

Habitat loss – e.g. Feunteun 2002.

Pollutants - Robinet and Feunteun 2002, Maes et al. 2005, Palstra et al. 2006, Geeraerts and Belpaire 2010.

Predation – e.g. Carpentier et al. 2009, DEFRA 2010, Wahlberg et al. 2014.

Summary:
One of the major threats to European Eel populations, like many anguillid species, is barriers to upstream and downstream migration, which also includes mortality by hydropower turbines and their associated screens and water management systems. Across Europe, there are a total of 24,350 hydropower plants and this figure is set to rise in the near future (van der Meer 2012). Indeed, in the Netherlands alone there are a total of 4,671 water pumping stations which inhibit the spawning migrations of adult silver eels downstream and the upstream migration of young glass eels. Degradation and loss of available habitat is also exacerbated by development, flood control, water-level management and the abstraction of surface and ground water for both domestic and commercial (e.g. agricultural) use. In North Africa, the declines in fisheries catches of all eel life history stages (but glass eel in particular) have been attributed to over-exploitation, dam construction, pollution of estuaries and water abstraction for domestic use (Azeroual 2010). It is proposed that the decline in good quality habitat and associated resources may be causing a decline in body condition of escaping silver eels in parts of the range which may have effects on the success of migration and/or spawning due this species’, particularly the female’s, reliance on fat stores for reproductive success.

In relation to this, the accumulation of lipophilic chemical pollutants by maturing eels could have potentially toxic effects on migrating adults. These chemicals are stored by the fish and released when fat stores are broken down during migration which could subsequently limit the capacity of the silver eels to complete their spawning migrations due to metabolic disruption (Robinet and Feunteun 2002, Palstra et al. 2006). Further, there is concern that even if the spawning migration is completed that lipid stores containing xenobiotics may result in disrupted gonadogenesis and/or low quality gametes (Robinet and Feunteun 2002).

Climate change has been proposed to play a role in fluctuations of abundance in A. anguilla – particularly larval transport and glass eel recruitment - through its impact on the suspected breeding grounds (Sargasso Sea) and on changing oceanic conditions that can influence the recruitment of glass eels to near shore and freshwater environments. An important consideration in this discussion is the time scale over which changes are thought to occur as a result of oceanic conditions. The North Atlantic Oscillation (NAO) and the associated climate variability that this brings to the North Atlantic have been dated as far back as the Holocene (Kim et al. 2004). As such, fluctuations in climate do occur naturally and have been influencing eel populations for millions of years (Minegishi et al 2005) during periods of increase and decline.

The NAO has been studied as a driver of recruitment in both the European and American eel, with published literature arguing for and against this hypothesis. Durif et al. (2011) indicated that periods of high NAO appear to negatively correlate with recruitment to freshwater habitats due to the metamorphosis of larvae into glass eels being impeded by the larvae being driven into colder water, slowing the process considerably. Further, changing ocean climate might potentially be responsible for fluctuations in productivity and thus food availability for leptocephali (Miller et al. 2009). Pacariz et al. (2014), however, found that the overall success of drift of larvae from the spawning ground to the East Atlantic was not affected by changes in climate between 1958-2008, suggesting that trends in recruitment are attributable to factors other than changing currents, a theory also supported by Henderson et al. (2012). As such, the most recent WGEEL report claims that there is still practically nothing known about the dynamics of the oceanic phase of the eels life history (ICES WGEEL 2013).

The parasite nematode (Anguillicola crassus), introduced when the Japanese Eel (A. japonica) was imported to Europe for culture in the early 1980s, is also thought to impact the ability of the European Eel to reach their spawning grounds due to its negative influence on the fitness traits associated with the silvering stage of maturation (Fazio et al. 2012) in addition to swimbladder damage which impairs swimming performance (Palstra et al. 2007) and the ability to cope with high pressure during their reproductive migration (Vettier et al. 2003, Sjöberg et al. 2009).

Overfishing of glass - fisheries are primarily in France, with the UK and Spain also contributing -, yellow and silver eels across Europe is also a threat to the species. Across its distribution all continental life history stages of the European Eel are currently exploited although data from different regions varies in quality and longevity. Export outside of Europe is now banned with any trade occurring within Europe (for consumption, culture and stocking) and quotas are in place, however, under-reporting, poaching and illegal trade are believed to occur throughout the range of the European eel fisheries. These activities endanger the species and make assessment of the impact of this fishery difficult, and it’s associated management problematic.

Given the relative lack of understanding of the threats we have attempted to quantify this using the IUCN ‘Threat Classification Scheme’, however, this is by no means definitive.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critically Endangered (CR) (A2bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The population of the common eel is threatened at present, and eel stocks have declined in recent years. However, there is currently very little scientific knowledge of this species, which would aid its management. The threats facing the species are unknown, however, pollution, overfishing, habitat degradation, parasite infection and changes in climate have all been forwarded as potential causes of the decline (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The majority of conservation actions historically in place for the European eel were set up and controlled at local and national level, often with little coordination which is of particular concern in relation to trans-boundary watersheds.

EMPs have been developed and implemented in EU Member States since the EC Regulation 1100/2007 was created to offer protection, promote recovery and increase of silver eel biomass and enhance the sustainable management of this species. The objective of each EMP is to reduce anthropogenic mortalities so as to permit, with high probability, the escapement to the sea of at least 40% of the silver eel biomass relative to the best estimate of escapement that would have existed if no anthropogenic influences had impacted the stock. Member States are responsible for implementing measures to achieve their targets, and these measures can include, but are not limited to; reducing commercial and recreational fisheries; restocking; improving habitats and making rivers passable; transportation of silver eels to the sea; reducing predation, amending hydro-electric power turbine schedules to reduce mortality, and developing aquaculture. According to the ICES WKEPEMP report (2013) most management actions have been for commercial and recreational fisheries, followed by hydropower-pumping stations obstacles, then measures on habitat, restocking, and predator control. Other actions expected to have indirect effects, such as implementing monitoring programmes and scientific studies, have been almost as common as controls on fisheries. A total of 756 management actions proposed in the EMPs have been implemented fully, 259 partially and 107 declared as not implemented at all (ICES WKEPEMP 2013).

In addition to EMPs, in 2007, the European eel was included in the CITES Appendix II in order to ensure trade of this commercially important species was sustainable. The listing came into effect on 13 March 2009, after which time all Parties to the Convention were required to issue permits for all exports of the species. An export permit may be issued only if the specimen was legally obtained and if the export is not detrimental to the survival of the species i.e. a Non-Detriment Finding. Finally in relation to international policy, in 2008, A. anguilla was added to the OSPAR List of Threatened and/or Declining Species in the Northeast Atlantic (OSPAR 2010).

As part of the EMPs, any Member State that allowed fishing for eels of <12 cm total length – generally referred to as glass eel fisheries - was required to reserve a minimum of 35% of their catch for restocking purposes (i.e. restocking rivers with glass eels from elsewhere) in 2010, rising to 60% from 31 July 2013. Whether restocking programmes actually enhance the population is still open to debate. In recent years, the ICES WGEEL has annually assessed new information on the pros and cons of stocking as a suitable tool for eel recovery, with fuller reviews undertaken in 2006 and 2010 (ICES 2010). Recent reviews (WGEEL 2012, Pawson 2012) on the contribution of stocking for the recovery of the panmictic European eel population unambiguously state that there are major knowledge gaps to be filled before firm conclusions either way can be drawn (ICES WGEEL 2013). To inform this debate, however, researchers are currently seeking to determine whether stocked individuals are able to migrate as successfully and contribute to future generations to the same degree as wild individuals. Long term stocking, marking and monitoring programmes are slowly making progress in this endeavour (Wickström and Sjöberg 2013). A team of researchers in France suggest that the stage at which eels are stocked does not affect their survival (Desprez et al. 2013). Tagging and tracking studies, such as those being conducted as part of the EU EELIAD project, are under way in order to gain a better understanding of the marine ecology of the European Eel. Tracking is also adopted to determine the relative success of stocked eels to make spawning migrations and thus contribute to recruitment (e.g. Prigge et al. 2013a) and a recent paper indicates that eels from a stocked watershed migrate in a similar way to wild populations in Sweden (Westerberg et al. 2013). In summary however, until stocking studies are accompanied by suitable controls of areas without translocation, it is very difficult to determine whether there is a net increase in silver eel escapement or differences in growth rates and/or sex ratios in manipulated populations (Pawson 2012).

Trap and transport programmes across Europe are designed to provide eels with both upstream and downstream passage and/or access to habitat that has been lost through the construction of migratory barriers. These programmes that involve catching wild eels and moving them over relatively small distances past barriers are generally working with lower numbers of fish than restocking programmes and are very location specific. However, when applied to migrating silver eels, low in a catchment, it can have a significant and immediate effect on escapement thus potentially having a positive impact on the spawning stock. It is hoped that translocation can mitigate against the loss of habitat and positively contribute to enhanced escapement, and by association, recruitment. There is a necessity in the future, however, to reduce the level of direct human intervention by providing more cost-effective passes or ladders for eels to navigate.

Continuous monitoring of eel escapement on a national or international scale is currently very rare and highly unlikely and so in addition to localised monitoring, modelling has been explored for providing estimates of escapement in eel subpopulations. The German Eel Model indicated that current levels of silver eel escapement from the Schwentine River system showed ‘distinctly lower reference escapement values’ than those set by the German EMP (Prigge et al. 2013). Indeed a report for the European Commission by Walker et al. (2011) review a number of assessment models (namely the Demographic model of the Camargue (DemCam); Eel Density Analysis 2.0 (EDA); German Eel Model (GEM); and, Scenario-based Model of Eel Production II (SMEP II)) using time series eel data sets from a variety of locations across Europe. The conclusions of this report suggest that all four models were capable of predicting escapement to a degree of accuracy (Walker et al. 2011).

In summary, the international assessment of the eel stock collated in the 2013 ICES WGEEL report confirms “the critical state of the stock; the promising increase in recruitment observed in the last two years is set in historical perspective; but no prediction can be generated, and no evaluation of the implemented stock protection measures achieved”. There is still a critical need for improvement in the quality and consistency of data reporting at the national and Eel Management Unit (EMU) level (ICES WGEEL 2013). Further, it is important to highlight that while conservation actions of varying effectiveness are in place for Anguilla anguilla across its range, more is still required, and the apparent rise in recruitment that has occurred in 2011, 2012 and 2013, should not be reason to cease efforts. It was proposed that reassessment of this species will be required in five years, or sooner should considerably more data on silver eel escapement become available in the next few years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The European Union is currently funding research that aims to halt the decline of the common eel population (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

European eels thrive on a diet of marine and freshwater fauna, so impact populations of other marine and freshwater organisms (Deelder, 1970). There are no direct adverse effects to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European eels are a popular food source for humans, especially in Europe and Asia. The eels also feed on the eggs of predatory fish such as trout, which keep ecosystems from overpopulation (Deelder, 1970).

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European eel

The European eel (Anguilla anguilla)[2] is a species of eel, a snake-like, catadromous fish. They can reach a length of 1.5 m (4 ft 11 in) in exceptional cases, but are normally around 60–80 cm (2.0–2.6 ft), and rarely reach more than 1 m (3 ft 3 in).

Life history[edit]

Main article: Eel life history

Much of the European eel’s life history was a mystery for centuries, as fishermen never caught anything they could identify as a young eel. Unlike many other migrating fish, eels begin their lifecycle in the ocean and spend most of their lives in fresh water, returning to the ocean to spawn and then die. In the early 1900s, Danish researcher Johannes Schmidt identified the Sargasso Sea as the most likely spawning grounds for European eels.[3] The larvae (leptocephali) drift towards Europe in a 300-day migration.[4] When approaching the European coast, the larvae metamorphose into a transparent larval stage called "glass eel", enter estuaries, and start migrating upstream. After entering fresh water, the glass eels metamorphose into elvers, miniature versions of the adult eels. As the eel grows, it becomes known as a "yellow eel" due to the brownish-yellow color of their sides and belly. After 5–20 years in fresh water, the eels become sexually mature, their eyes grow larger, their flanks become silver, and their bellies white in color. In this stage, the eels are known as "silver eels", and they begin their migration back to the Sargasso Sea to spawn.

Conservation status[edit]

The European eel is a critically endangered species.[1] Since the 1970s, the numbers of eels reaching Europe is thought to have declined by around 90% (possibly even 98%). Contributing factors include overfishing, parasites such as Anguillicola crassus, barriers to migration such as hydroelectric plants, and natural changes in the North Atlantic oscillation, Gulf Stream, and North Atlantic drift. Recent work suggests polychlorinated biphenyl pollution may be a factor in the decline.[5]

Eels have been important sources of food both as adults (including the famous jellied eels of East London) and as glass eels. Glass-eel fishing using basket traps has been of significant economic value in many river estuaries on the western seaboard of Europe.

In captivity, European eels can live for very long times.[6] According to a report in The Local, a specimen lived 155 years in the well of a family home in Brantevik, a fishing village in southern Sweden.[7]

Sustainable consumption[edit]

In 2010, Greenpeace International added the European eel to its seafood red list.[8]

Decreasing population numbers and breeding projects[edit]

For quite some time, the population number of European eels has been falling, so a research project has been started by Innovatie Netwerk, led by Henk Huizing, to see whether it is possible to breed European eels in captivity. The breeding of European eel is very difficult, since eels are generally only able to reproduce after having swum a distance of 6,500 km (4,000 mi). In the project, this is being simulated by means of a hometrainer for the fish. Innovatie Netwerk has also started a breeding project, called InnoFisk Volendam.[9][10]

Commercial fisheries[edit]

Global production of European eels in tonnes as reported by the FAO
↑  Wild capture, 1950–2010 [11]
↑  Farmed production, 1950–2010 [11]
↑  Total production of European eel in thousands of tonnes as reported by the FAO, 1950–2010[11]
↑  Main European countries producing farmed European eel

Gallery[edit]

References[edit]

  1. ^ a b Jacoby, D. & Gollock, M. (2014). "Anguilla anguilla". IUCN Red List of Threatened Species. Version 2014.1. International Union for Conservation of Nature. Retrieved 30 June 2014. 
  2. ^ "Anguilla anguilla". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  3. ^ Schmidt, J. (1912) Danish researches in the Atlantic and Mediterranean on the life-history of the Fresh-water Eel (Anguilla vulgaris, Turt.). Internationale Revue der gesamten Hydrobiologie und Hydrographie 5: 317-342.
  4. ^ "FAO Fisheries & Aquaculture Anguilla anguilla". Fao.org. 2004-01-01. Retrieved 2012-08-02. 
  5. ^ "PCBs are killing off eels". New Scientist 2452: 6. 2006. 
  6. ^ (Swedish) Branteviksålen kan vara världens äldsta, 2008.
  7. ^ "The Local". 2014.  |chapter= ignored (help)
  8. ^ Greenpeace International Seafood Red list
  9. ^ EOAS magazine, september 2010
  10. ^ Innofisk Volendam breedign project
  11. ^ a b c Based on data sourced from the FishStat database, FAO.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!