Overview

Comprehensive Description

Epinephelus adscensionis (Osbeck, 1765)

Materials

Type status: Other material. Occurrence: catalogNumber: CIRR-290 ; recordedBy: Salvador Zarco Perello ; individualCount: 3 ; Location: continent: America; country: Mexico ; stateProvince: Yucatan; locality: Madagascar Reef ; verbatimDepth: 5 m; verbatimLatitude: 781272.611854; verbatimLongitude: 2373443.69326; verbatimCoordinateSystem: UTM 15N; verbatimSRS: WGS84; decimalLatitude: 21.441469 ; decimalLongitude: -90.286290 ; Event: samplingProtocol: Photosampling ; eventDate: 8/10/2007 ; Record Level: collectionID: YUC-PEC_239-01-64; institutionCode: UMDI-SISAL ; collectionCode: CIRR

Distribution

Western Atlantic: Massachusetts to South Brazil. Including Bermuda, Bahamas and throughout the Caribbean Islands. Eastern Atlantic: St. Helena, Ascension Island and SãoTomé .

  • Zarco Perello, Salvador, Moreno Mendoza, Rigoberto, Simoes, Nuno (2014): Checklist of Fishes from Madagascar Reef, Campeche Bank, Mexico. Biodiversity Data Journal 2, 1100: 1100-1100, URL:http://dx.doi.org/10.3897/BDJ.2.e1100
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits rocky reefs. Usually solitary (Ref. 29). Feeds mainly on crabs (67%) and fishes (20%). At Ascension I., it feeds on juvenile Melichthys niger and young sea turtles. Difficult to approach (Ref. 9710). Its flesh is of good quality. Marketed fresh. Angling: Like other grouper, rock hind are caught by fishing at the right depth over an irregular bottom (Ref. 84357).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Epinephelus adscensionis is a wide-ranging species known from Ascension and St. Helena Islands in the central and eastern Atlantic, and in the western Atlantic from USA (Massachusetts (one record), South Carolina, Georgia, Florida), Bermuda, Gulf of Mexico, and the Caribbean (Greater Antilles and Lesser Antilles), to southern Brazil (including Villa des Remedios Is (northeast of Natal), Abrolhos, Fernando de Noronhas, Trinidade). It has also been recorded from São Tomé in the Gulf of Guinea (Heemstra and Randall 1993), and the Azores (Portugal) (Myers distributional database 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda to the Gulf of Mexico, the Caribbean and southern Brazil. Eastern Atlantic: Ascension and St. Helena islands; dubious records from the Canary Islands, Cape Verde and South Africa (Ref. 1496, 1953, 6572) are discussed by Heemstra (Ref. 6512). Also recorded from eastern Atlantic from Sao Tome in the Gulf of Guinea and from the Azores (Portugal) (Ref. 089707).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda to the Gulf of Mexico, the Caribbean and southern Brazil. Including Antilles and coasts of Central and South America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic and eastern Atlantic islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 16 - 17; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 610 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

61.0 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 4,080 g (Ref. 40637); max. reported age: 12 years (Ref. 31618)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Potts, J.C. and C.S. Manooch III 1995 Age and growth of red hind and rock hind collected from North Carolina through the Dry Tortugas, Florida. Bull. Mar. Sci. 56(3):784-794. (Ref. 31618)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Maxilla without scales. Preopercle with rounded, only slightly enlarged, spines at its angle. Opercle with 3 flat spines, middle one the largest. Pelvic fins shorter than pectorals and shorter than longest dorsal spine. Bases of soft dorsal and anal fins covered with scales and thick skin. 2 or 3 dark saddles along base of dorsal fin and another on top of caudal peduncle. Tan with red spots on head, body and fins, spots becoming larger ventrally (Ref. 26938); characterized further by: body depth less than head length, 2.6-3.2 times in SL; head length 2.1-2.5 in SL; interorbital area flat or slightly concave; preopercle evenly serrate; smooth subopercle and interopercle; subequal posterior and anterior nostrils (Ref. 089707).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
E. adscensionus occurs on rocky reefs in depths of 2 to 100 m.

Feeding
E. adscensionus feeds mainly on crabs (67%) and fishes (20%). At Ascension Island, rock hind include juvenile triggerfish (Melichthys niger) and young sea turtles in their diet. At St. Helena, E. adscensionis are common in shallow water and represent 90% of “groundfish” landings; large adults (over 50 cm) are taken regularly in 50 to 100 m, but are rare in shallow water (Heemstra and Randall 1993).

Reproduction and maturity
Only the Ascension Island population contained mature individuals at the time of sampling (May to June). Female maturity occurred at 350 mm FL and four years of age. The presence of older individuals with sexually transitional gonads indicates protogynous hermaphroditism. However histological analysis of small individuals was too sparse to allow unambiguous identification of male recruitment pathways.

Mean testis wt in mature individuals 7.3±0.6 gms
Mean ovary wt in mature individuals 39.8±6.9 gms

This, plus observations, suggest that some spawning occurs within the context of small haremic groups.

Fishers in Belize have identified E. adscensionus as a group spawning species in the Gladdens Spit area (Heyman 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 1 - 120 m (Ref. 36484), usually ? - 15 m (Ref. 3589)
  • Willoughby, S., J.D. Neilson and C. Taylor 1999 The depth distribution of exploited reef fish populations off the south and west coasts of Barbados. Proc. Gulf Caribb. Fish Inst. 45:57-68. (Ref. 36484)
  • Smith, C.L. 1990 Serranidae. p. 695-706. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 2. (Ref. 3589)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 71 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 0 - 56
  Temperature range (°C): 23.384 - 27.978
  Nitrate (umol/L): 0.161 - 2.147
  Salinity (PPS): 34.667 - 37.020
  Oxygen (ml/l): 4.313 - 4.773
  Phosphate (umol/l): 0.055 - 0.239
  Silicate (umol/l): 0.805 - 4.026

Graphical representation

Depth range (m): 0 - 56

Temperature range (°C): 23.384 - 27.978

Nitrate (umol/L): 0.161 - 2.147

Salinity (PPS): 34.667 - 37.020

Oxygen (ml/l): 4.313 - 4.773

Phosphate (umol/l): 0.055 - 0.239

Silicate (umol/l): 0.805 - 4.026
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 100m.
From 1 to 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits rocky reefs. Feeds mainly on crabs (67%) and fishes (20%). Typically found in shallow water over a rocky bottom with some surf action (Ref. 33). Carnivore (Ref. 57616).
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847. (Ref. 33)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus adscensionis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACTGCACTCAGCCTGCTCATCCGAGCTGAGCTAAGCCAACCAGGAGCCCTACTAGGTGACGATCAAATCTATAATGTAATTGTTACGGCACACGCTTTCGTGATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTCGGAAACTGACTCATCCCACTTATAATTGGAGCCCCAGACATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTGCTTCTCCTAGCTTCCTCTGGGGTTGAAGCCGGTGCCGGCACCGGGTGAACAGTATACCCACCTCTAGCCGGGAATCTGGCCCATGCAGGAGCATCCGTAGACCTTACTATCTTCTCACTACACCTAGCAGGTGTTTCATCAATTTTAGGGGCAATTAACTTTATCACGACCATCATTAACATGAAACCCCCTGCCATTTCTCAATATCAAACACCCCTGTTTGTATGAGCCGTCCTAATTACAGCAGTGCTACTGCTCCTATCCCTTCCCGTTCTTGCCGCTGGTATTACAATACTTTTAACAGACCGTAATCTAAACACCACCTTTTTTGACCCAGCCGGAGGGGGTGACCCAATTCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus adscensionis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Rocha, L., Ferreira, B., Choat, J.H., Craig, M.T., Sadovy, Y. & Bertoncini, A.A.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
E. adscensionus is listed as Least Concern because it is widespread and abundant in many parts of its range even in fished areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Detailed analyses of the demography of E. adscensionus are available from the Islands of Ascension and St. Helena courtesy of the Fisheries Directorate St. Helena. On both Islands E. adscensionus was one of the few serranids present in reefal waters and a line fishery that extended to 60 m recorded only this species of serranid.

Fishery-independent
The abundance estimates (Table 1) represent some of the highest densities recorded for serranids on shallow reefs. However the low abundances recorded from sites adjacent to major population centres on St. Helena identify a potential to remove this species from specific localities. Very high abundances were recorded from one locality in deeper water on the north coast of Ascension indicating a possible groups spawning site.

Follow the link below for Table 1: abundance patterns (count results).

Population dynamics
Estimates of age structure from St. Helena and Ascension and from one Caribbean site showed that this species is fast growing and relatively short lived reaching 300 mm FL in four years with a maximum size of 60 cm.

Follow the link below for Table 2: estimates of age structure from St. Helena and Ascension.

Both St. Helena and Ascension populations displayed very similar demographic characteristics despite the relative positions in tropical and subtropical water masses. No difference in length weight relationships was identified between the island populations.

Analysis of a small sample from Los Roques in the northern Caribbean showed a size range from 190 to 545 mm FL and 4 to 12 years in age.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Fishery-dependent
Although E. adscensionus is targeted by some tropical western Atlantic fisheries, the numbers taken are relatively small (Harper et al. 2000). However the isolated populations of Ascension and St. Helena represent targeted fisheries. On both island this species is subject to a local line fishery and is the main shallow water species targeted. The fishery is more intense on St. Helena. UVC on both islands identified fishing effects especially on St. Helena.

The St Helena fishery especially is increasing and now stands at approx 45 metric tonnes of E. adscensionus per year. Although effort has also increased there no evidence at this time of a decline in CPUE. However the evidence from the St. Helena UVC data strongly suggests localized depletion of this species in fished areas.

The potential for an export fishery exists in St. Helena once an international airport is established.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Closure of areas suggested due to local depletion and low rate of movement in shallow reef populations of E. adscensionus. In St. Helena, there is a catch limit of 45 metric tonnes per year. It occurs in some protected areas in its range, including the Gladden Spit Marine Reserve in Belize where spawning aggregations have been reported.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!