Overview

Comprehensive Description

Biology

Inhabit Thalassia beds and coral reefs. In the Gulf of Mexico, they are found on rocky reef ledge in depths greater than 27 m. Solitary (Ref. 26340) and secretive, they usually stay near hiding places during the day. Prefer to remain within a small area of the home range of about 2,120 square m especially during the day (Ref. 56524). Are nocturnal predators, adults feed mainly on fishes, with preference on Chromis multilineata, juveniles feed on shrimps. Due to its small size, this is not a particularly sought-after species. Easily approached and fed by divers (Ref. 9710). Protogynous (Ref. 26938). Between 1995 and 2000, at least 10 specimens have been traded as aquarium fish at Ceará, Brazil (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Central Atlantic: North Carolina to southern Florida (USA), Bermuda, Gulf of Mexico, Bahamas, and the Caribbean; including the Antilles (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

42.6 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 1,130 g (Ref. 40637); max. reported age: 13 years (Ref. 36271)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by having the following characteristics: body depth 2.5-2.9 times in SL; head length 2.4-2.6 times in SL (Ref. 089707); opercle with 3 flat spines, middle one the largest and upper spine longer than the lowest; pelvic fins shorter than pectorals; bases of soft dorsal and anal fins covered with scales and thick skin; has 4 contrasting spots, white or black, along body below dorsal fin base (Ref. 26938); color in market: pale orange, grey or brown with reddish spots; black spots on the upper body below the dorsal fin (Ref. 089707).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1143 specimens in 1 taxon.
Water temperature and chemistry ranges based on 785 samples.

Environmental ranges
  Depth range (m): 0 - 211
  Temperature range (°C): 15.839 - 28.067
  Nitrate (umol/L): 0.115 - 14.710
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 3.108 - 4.791
  Phosphate (umol/l): 0.046 - 1.177
  Silicate (umol/l): 0.805 - 6.435

Graphical representation

Depth range (m): 0 - 211

Temperature range (°C): 15.839 - 28.067

Nitrate (umol/L): 0.115 - 14.710

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 3.108 - 4.791

Phosphate (umol/l): 0.046 - 1.177

Silicate (umol/l): 0.805 - 6.435
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory (Ref. 56524); marine; depth range 0 - 170 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1143 specimens in 1 taxon.
Water temperature and chemistry ranges based on 785 samples.

Environmental ranges
  Depth range (m): 0 - 211
  Temperature range (°C): 15.839 - 28.067
  Nitrate (umol/L): 0.115 - 14.710
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 3.108 - 4.791
  Phosphate (umol/l): 0.046 - 1.177
  Silicate (umol/l): 0.805 - 6.435

Graphical representation

Depth range (m): 0 - 211

Temperature range (°C): 15.839 - 28.067

Nitrate (umol/L): 0.115 - 14.710

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 3.108 - 4.791

Phosphate (umol/l): 0.046 - 1.177

Silicate (umol/l): 0.805 - 6.435
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 170m.
Recorded at 170 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabit Thalassia beds and coral reefs. In the Gulf of Mexico, they are found on rocky reef ledge in depths greater than 27 m. Solitary (Ref. 26340) and secretive, they usually stay near hiding places during the day. Prefer to remain within a small area of the home range of about 2,120 square m especially during the day (Ref. 56524). Carnivore (Ref. 57616). Are nocturnal predators, adults feed mainly on fishes, with preference on Chromis multilineata, juveniles feed on shrimps. Due to its small size, this is not a particularly sought-after species. Easily approached and fed by divers (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Most change sex between 20 and 23 cm (ages 4 and 5), with sexual transition occurring immediately after spawning in August and September (Ref. 3092).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis cruentata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGAACTGCACTCAGTCTTTTAATTCGGGCTGAACTAAGCCAGCCGGGTGCTCTCCTGGGAGATGACCAAATCTATAATGTTATCGTCACAGCTCACGCCTTTGTAATGATTTTTTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTTATCCCACTAATAATTGGTGCCCCTGATATAGCATTTCCTCGAATAAATAACATGAGCTTCTGACTTCTTCCCCCATCCTTCCTTCTTCTCTTAGCTTCCTCCGGAGTAGAAGCTGGAGCTGGGACTGGCTGAACGGTATACCCCCCTTTAGCCGGCAACTTAGCCCACGCAGGAGCATCTGTTGACCTAACAATTTTTTCTCTACATCTAGCTGGTATCTCATCAATTCTTGGAGCAATTAATTTCATTACAACTATTATTAACATAAAACCCCCCGCTATTTCTCAGTACCAAACACCTCTATTTGTCTGAGCCGTACTAATTACTGCTGTTCTTCTACTCCTCTCCCTTCCTGTTCTTGCCGCTGGTATTACAATACTTCTAACCGATCGAAACCTAAACACCACGTTCTTTGACCCAGCTGGTGGAGGAGACCCTATTCTTTACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis cruentata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Graysby

The Graysby, Cephalopholis cruentata, is a Grouper in the Serranidae family from the Western Atlantic. It is found from North Carolina to southern Florida (USA), Bermuda, the Gulf of Mexico, the Bahamas, and the Caribbean. Its typical size is 15 to 25 cm (6 to 10 in.) in length, with a maximum size of 42 cm (16 in.).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!