Overview

Comprehensive Description

Biology

Inhabit Thalassia beds and coral reefs. In the Gulf of Mexico, they are found on rocky reef ledge in depths greater than 27 m. Solitary (Ref. 26340) and secretive, they usually stay near hiding places during the day. Prefer to remain within a small area of the home range of about 2,120 square m especially during the day (Ref. 56524). Are nocturnal predators, adults feed mainly on fishes, with preference on Chromis multilineata, juveniles feed on shrimps. Due to its small size, this is not a particularly sought-after species. Easily approached and fed by divers (Ref. 9710). Protogynous (Ref. 26938). Between 1995 and 2000, at least 10 specimens have been traded as aquarium fish at Ceará, Brazil (Ref. 49392).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Cephalopholis cruentata is found in the North Atlantic and within the Caribbean (Greater Antilles and Lesser Antilles), Trinidad, Gulf of Mexico, USA (North Carolina to southern Florida), Bahamas and Bermuda. There are unsubstantiated records from Brazil, but no specimens or photographs from there.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Central Atlantic: North Carolina to southern Florida (USA), Bermuda, Gulf of Mexico, Bahamas, and the Caribbean; including the Antilles (Ref. 26938).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 350 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

42.6 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 1,130 g (Ref. 40637); max. reported age: 13 years (Ref. 36271)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Opercle with 3 flat spines, middle one the largest and upper spine longer than the lowest. Pelvic fins shorter than pectorals. Bases of soft dorsal and anal fins covered with scales and thick skin. Has 4 contrasting spots, white or black, along body below dorsal fin base (Ref. 26938).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Cephalopholis cruentata is found in Thalassia beds and on coral reefs from shore to depths of 170 m. In the eastern Gulf of Mexico, it occurs on the rocky reef ledge in depths greater than 27 m. It is strongly associated with its habitat and is susceptible to habitat degradation. Graysby are small, secretive fish that usually stay near hiding places in the reef during the day.

Age, growth and reproduction
Nagelkerken (1979) found that at the end of their first year; graysby were 8 cm long (standard length) and had formed seven growth rings in their otoliths. Females mature at 16 cm (total length) and most change sex between 20 and 23 cm (ages four and five), with sexual transition occurring immediately after spawning in August and September.

The observations on protogyny by Nagelkerken (1979) and Potts and Manooch (1999) confirm the suggestions of (Thompson and Munro 1983) but a more detailed histological analysis is required to confirm sexual pattern. Thompson and Munro (1978) estimated the number of eggs per spawning at 262 to 604 for a fish of 29 cm total length. Hawkins et al. (in press) estimated size at first female maturity for the St Lucia population at 16 cm FL with 100% maturity at 26 cm FL with only 12% of the trapped sample being immature females.

Feeding
They are crepuscular predators, and adults feed mainly on fishes, with a preference for Chromis multilineata where this species is abundant (Heemstra and Randall 1993).

Home range and movement
Tagging with acoustic transmitters in St. Lucia (Popple and Hunte 2005) showed that this species had a mean home range of 2,120 m² and showed a clear preference for areas with high levels of reef complexity.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory (Ref. 56524); marine; depth range 0 - 170 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1143 specimens in 1 taxon.
Water temperature and chemistry ranges based on 785 samples.

Environmental ranges
  Depth range (m): 0 - 211
  Temperature range (°C): 15.839 - 28.067
  Nitrate (umol/L): 0.115 - 14.710
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 3.108 - 4.791
  Phosphate (umol/l): 0.046 - 1.177
  Silicate (umol/l): 0.805 - 6.435

Graphical representation

Depth range (m): 0 - 211

Temperature range (°C): 15.839 - 28.067

Nitrate (umol/L): 0.115 - 14.710

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 3.108 - 4.791

Phosphate (umol/l): 0.046 - 1.177

Silicate (umol/l): 0.805 - 6.435
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 170m.
Recorded at 170 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit Thalassia beds and coral reefs. In the Gulf of Mexico, they are found on rocky reef ledge in depths greater than 27 m. Solitary (Ref. 26340) and secretive, they usually stay near hiding places during the day. Prefer to remain within a small area of the home range of about 2,120 square m especially during the day (Ref. 56524). Carnivore (Ref. 57616). Are nocturnal predators, adults feed mainly on fishes, with preference on Chromis multilineata, juveniles feed on shrimps. Due to its small size, this is not a particularly sought-after species. Easily approached and fed by divers (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Most change sex between 20 and 23 cm (ages 4 and 5), with sexual transition occurring immediately after spawning in August and September (Ref. 3092).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cephalopholis cruentata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cephalopholis cruentata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGAACTGCACTCAGTCTTTTAATTCGGGCTGAACTAAGCCAGCCGGGTGCTCTCCTGGGAGATGACCAAATCTATAATGTTATCGTCACAGCTCACGCCTTTGTAATGATTTTTTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTTATCCCACTAATAATTGGTGCCCCTGATATAGCATTTCCTCGAATAAATAACATGAGCTTCTGACTTCTTCCCCCATCCTTCCTTCTTCTCTTAGCTTCCTCCGGAGTAGAAGCTGGAGCTGGGACTGGCTGAACGGTATACCCCCCTTTAGCCGGCAACTTAGCCCACGCAGGAGCATCTGTTGACCTAACAATTTTTTCTCTACATCTAGCTGGTATCTCATCAATTCTTGGAGCAATTAATTTCATTACAACTATTATTAACATAAAACCCCCCGCTATTTCTCAGTACCAAACACCTCTATTTGTCTGAGCCGTACTAATTACTGCTGTTCTTCTACTCCTCTCCCTTCCTGTTCTTGCCGCTGGTATTACAATACTTCTAACCGATCGAAACCTAAACACCACGTTCTTTGACCCAGCTGGTGGAGGAGACCCTATTCTTTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Rocha, L., Ferreira, B., Choat, J.H., Craig, M.T., Sadovy, Y. & Bertoncini, A.A.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephalopholis cruentata is listed as Least Concern because it is currently a widespread and common species that is presently withstanding significant fishing pressure. In the future, increasing fishing pressure and habitat loss may lead to significant decline and future assessments are warranted as more information becomes available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Fisheries-dependent data
Abundance data from Curacoa (Nagelkerken et al. 2005) shows that Cephalopholis cruentata was moderately abundant on reef slopes with peak abundances ranging from 10.5 to 11.7 per 1,000 m² during two widely separated sampling periods 1973 and 2003. The authors detected no major time-associated trends in abundance over the three-decade time period despite a 58% reduction in hard coral cover and continuous fishing activity. However, the depth distributions at which peak abundances occurred shifted downwards from 9 m in 1973 to 20 to 27 m in 2003.

Fisheries-independent data
Follow the link below for Table 1: results of comparisons of demography and size structure of five Caribbean populations of graysby (K. Ranatunga, PhD data) subject to heavy (Barbados, Belize), moderate (Curacao), light (Las Aves), and full protection (Los Roques) lying within the same latitudinal stratum.

The most consistent feature is the association of reduced maximum age and size and higher mortality rates with increased fishing. Although this species is not a major commercial target, artisanal trap and line fishing at a number of sites appear to be impacting on fished populations.

A comprehensive size-based earlier study on tropical Atlantic serranids (Thompson and Munro 1983) demonstrated the that graysby was a relatively minor element of the serranid catch in the intensively fished areas around Jamaica in the 1970s. The data on sex and size distributions suggested protogyny with a sex ratio strongly biased toward females (1:6) which the authors suggest reflects intensive fishing on larger individuals in the Port Royal area. Modal sizes for catches in the vicinity of Jamaica were 20 to 24 cm FL. This was low compared to recent samples (Ranatrunga 2006). However, the main findings of Thompson and Munro (1983) were that samples of this species were very small compared to most of the other exploited serranids in the locality suggesting that this species is relatively rare and has never been a targeted species in the serranid commercial fisheries of the Caribbean.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
General
The major threats to graybsy appear to be overfishing and habitat loss and degradation.

Overfishing
Although graysby are heavily fished over much of its range at present, this appears to be having little impact on the population. However, if this threat increases, it will presumably have a significant effect in the future.

This species is the subject of a minor fishery in Florida waters with a high proportion of catches being released (Harper et al. 2000). Thompson and Munro (1983) have provided catch statistics of this and a number of other Caribbean groupers.

In Curacao, this is a commercially important species that constitutes 11% of the reef fish catch (Nagelkerken et al. 2005). Gobert et al. (2005) show that while C. cruentata had a long history in the Honduran line, trap and spear fishery, it made up only a small proportion of the total reef fish catch in 1999 which confirms that it is not a highly targeted fishery species in most localities.

The recent evidence suggests some impacts of artisinal fisheries in Barbados and Belize although the impacts of these fisheries need to be evaluated through abundance estimates, as was done for the Curacao population (Nagelkerken et al. 2005).

Fishery records (Thompson and Munro 1983, Harper et al. 2000) suggest low catch rates reflect small size and relatively low abundance. However Potts and Manooch (1999) point to increasing catch rates, Harper et al. (2000) confirm that although this species is taken in the Florida recreational fishery the numbers are small with a high proportion of releases.

The most definitive fishery data is provided by Nagelkerken et al. (2005). Despite that this species was the target of a commercial fishery in Curacao and constituted 11% of the reef fish catch there were no significant changes in abundance over a 30 yr period although the population shifted to deeper habitats.

Hawkins et al. (in press) have shown that while C. cruentata represents about 2 to 3% of the reef fish population in St. Lucia (light fishing) and Jamaica (heavily fished) they were not considered to be highly “trappable” at either locality when compared to taxa such as haemulids and lutjanids.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are a few protected areas in the graysby's range. The establishment of MPAs in areas of complex reef habitat and that reduce fishing pressure on this and other small serranids are recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Graysby

The Graysby, Cephalopholis cruentata, is a Grouper in the Serranidae family from the Western Atlantic. It is found from North Carolina to southern Florida (USA), Bermuda, the Gulf of Mexico, the Bahamas, and the Caribbean. Its typical size is 15 to 25 cm (6 to 10 in.) in length, with a maximum size of 42 cm (16 in.).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!