Overview

Brief Summary

The Nile tilapia, Oreochromis niloticus, is a cichlid fish native to North, East and Central Africa, and Israel. Like other tilapia species, O. niloticus is easily and inexpensively farmed and was introduced (and subsequently established itself) in much of the tropical and subtropical world via aquaculture mainly between 1960-80 as a highly desirable alternative to the earlier (between 1940-60) introduced Mozambique tilapia O. mossambicus. Omnivorous, tolerant of wide temperature and water quality and salinity ranges, fast-breeding with an effective reproductive strategy of mouthbreeding to protect and transport its young, and difficult to eradicate, the Nile tilapia, like other tilapia species, has profoundly and negatively effected the biodiversity, ecology and water quality of many ecosystems outside its native range.

(Food and Agriculture Organization of the United Nations, factsheet; Global Invasive Species Database, Invasive Species Specialist Group (ISSG), 2008; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to tropical and subtropical Africa and the Middle East; possibly established in Lake Seminole, Florida-Georgia (Fuller et al. 1999). A breeding population has inhabited Robinson Bayou in the Pascagoula River drainage, Mississippi, since the late 1990s (Peterson et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern and eastern Africa; introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 490 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 600 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 116 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 1 - 40

Graphical representation

Depth range (m): 1 - 40
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Tilapia nilotica (Tilapia nilotica, adult) is prey of:
Homo sapiens
Actinopterygii
Aves

Based on studies in:
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)

This list may not be complete but is based on published studies.
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Tilapia nilotica (Tilapia nilotica, adult) preys on:
algae
phytoplankton

Based on studies in:
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)

This list may not be complete but is based on published studies.
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreochromis niloticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 46 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGATTCTTCTCAACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACCGCGCTAAGCCTCCTAATTCGGGCAGAACTAAGCCAGCCCGGCTCTCTCCTCGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAGTACCACTCATGATTGGTGCCCCAGATATGGCCTTCCCTCGAATGAACAACATGAGTTTCTGACTCCTCCCTCCCTCATTCCTCCTCCTCCTCGCCTCATCTGGAGTCGAAGCAGGTGCCGGCACAGGGTGAACTGTTTACCCCCCGCTCGCAGGCAATCTTGCCCATGCTGGGCCTTCTGTCGACTTAACCATCTTCTCCCTCCACTTGGCCGGGGTGTCATCTATTCTAGGCGCAATTAATTTCATTACAACAATCATTAACATGAAACCCCCCGCCATCTCTCAATATCAAACACCCCTATTTGTATGGTCCGTTCTAATTACCGCAGTATTACTTCTTCTATCCCTACCCGTTCTTGCCGCCGGCATCACAATACTTCTCACAGACCGAAACCTAAACACAACCTTCTTTGATCCTGCCGGAGGAGGAGACCCCATCCTTTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTTTACATTCTTATCCTCCCCGGCTTTGGAATAATCTCCCACATTGTTGCTTACTATGCGGGTAAAAAAGAACCTTTCGGATATATGGGAATGGTCTGGGCCATGATGGCTATCGGCCTCCTAGGGTTCATTGTATGAGCCCATCACATGTTCACCGTAGGAATGGACGTAGACACACGGGCTTACTTTACTTCCGCCACAATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTGCACGGCGGTGCCATTAAATGAGAAACCCCACTCTTATGAGCGCTAGGTTTCATCTTCCTCTTTACAGTTGGAGGTCTAACCGGAATTGTCCTAGCCAATTCTTCTCTAGACATTATGCTTCACGACACATATTATGTCGTCGCCCACTTCCACTATGTCCTTTCAATAGGAGCCGTATTCGCCATCGTTGCCGGCTTCGTCCACTGATTCCCCCTATTCTCAGGATACACACTTCACGACACCTGAACTAAAATCCACTTCGGAGTTATGTTTATCGGAGTCAACCTTACTTTCTTCCCACAACATTTCCTGGGACTGGCAGGAATGCCTCGTCGGTACTCCGACTATCCCGACGCCTATACCCTTTGAAACACAGTCTCTTCTATTGGCTCAATGATCTCAATAGTCGCAGTGATTATGTTCCTATTTATTATCTGAGAAGCATTCGCCGCTAAACGAGAAGTTCTATCAGTAGAACTTACAGCAACAAACGTAGAATGACTTCACGGCTGCCCTCCTCCCTACCACACCTTCGAAGAGCCTGCCTTCGTCCAAGTTCAACAAACTTGGCTAGACTACGAAAAATCCACTACCGCCCCCTCAAAAGCCCACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oreochromis niloticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Specimens with Barcodes: 159
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Oreochromis niloticus

The Nile tilapia, Oreochromis niloticus is a relatively large cichlid fish native to Africa from Egypt south to East and Central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range (e.g. Brazil).[1]

It is also commercially known as mango fish, Nilotica or boulti.[2][not in citation given] The first name leads to easy confusion with another tilapia that is traded commercially, the mango tilapia (Sarotherodon galilaeus).

Contents

Description [edit]

The Nile tilapia has distinctive, regular, vertical stripes extending as far down the body as the bottom edge of the caudal fin, with variable coloration. Adults reach up to 60 cm (24 in) in length and up to 4.3 kg (9.5 lb). It lives for up to 9 years. It tolerates brackish water and survives temperatures between 8 and 42 °C (46 and 108 °F).

It has been variously reported in the literature to be a plankton feeder, an omnivore, and to feed on higher plants to the extent it may be used in control of aquatic weeds. Introduced tilapia can, on the other hand, easily become an invasive species (see Tilapia as exotic species).

It is a species of high economic value and is widely introduced outside its natural range; probably next to the Mozambique tilapia (O. mossambicus), it is the most commonly cultured cichlid.[citation needed]

Aquaculture [edit]

Aquaculture of the Nile tilapia goes back to Ancient Egypt, where it was called ỉn.t and represented by hieroglyph K1 of the Gardiner List. As a logogram, this meant "a Nile tilapia". Used as a determinative (ideogram), it apparently signified Nile tilapia and/or flathead mullets which, like the tilapia, were commercially important fish, namely in the Nile delta:

K1Z1s

If used as part of a phonogram, it represented the sound ỉn:

K1

In modern aquaculture, wild-type Nile tilapia are not too often seen, as their flesh has a dark color that is not much desired by many customers, and because it has a bit of a reputation of being a trash fish associated with poverty.[3] On the other hand, they are fast-growing and give good fillets; leucistic ("red") breeds which have lighter meat have been developed and these are very popular.

Hybrid stock is also used in aquaculture; Nile × blue tilapia hybrids are usually rather dark, but a light-colored hybrid breed known as "Rocky Mountain White" tilapia is often grown due to its very light flesh and tolerance of low temperatures.[3]

The Nile tilapia has recently been discovered in a small stream in central Arkansas. This invasive species may harm the other aquatic life present in this stream within the next few years, depending on how quickly it is able to reproduce and how adapted it is to competition with other aquatic vertebrates. Evidence supports the possibility that the Nile tilapia has established a strong breeding ground and will eventually endanger other fish species, possibly competitively exclude them.

In the Philippines [edit]

Gastronomy [edit]

Pla thapthim at Thanin market in Chiang Mai
Live pla nin on a table at a Thai market

The red-hybrid Oreochromis niloticus is known in the Thai language as pla thapthim (Thai: ปลาทับทิม), meaning "pomegranate fish" or "ruby fish".[6] This type of tilapia is very popular in Thai cuisine where it is prepared in a variety of ways.[7]

The black and white striped tilapia pla nin (Thai: ปลานิล), meaning "Nile fish", is commonly either salted and grilled or deep-fried, and it can also be steamed with lime (pla nin nueng manao).[8]

Nile tilapia, called بلطي bulṭī in Arabic, is (being native to Egypt) among the most common fish in Egyptian cuisine, and probably the most common in regions far from the coast. It is generally either battered and pan-fried whole (بلطي مقلي bulṭī maqlī [bʊltˤiː maʔliː]) or grilled whole (بلطي مشوي bulṭī mashwī [bʊltˤiː maʃwiː]). Like other fish in Egypt, is generally served with rice cooked with onions and other seasonings to turn it red.

Systematics [edit]

O. niloticus niloticus

The forms referred to as Oreochromis (or Tilapia) "Nyabikere" and "Kabagole" seem to belong to this species, too. An undescribed[verification needed] population found at, for example, Wami River, Lake Manyara and Tingaylanda seems to be a close relative.[10]

Medical significance [edit]

In recent research done in Kenya, this fish has been shown to feed on mosquito larvae, making it a possible tool in the fight against malaria in Africa.[11]

See also [edit]

Notes [edit]

  1. ^ Azevedo-Santos, V.M.; O. Rigolin-Sá, and F.M. Pelicice (2011). "Growing, losing or introducing? Cage aquaculture as a vector for the introduction of non-native fish in Furnas Reservoir, Minas Gerais, Brazil". Neotropical Ichthyology 9: 915–919. 
  2. ^ Nile Tilapia. Seafood Portal.
  3. ^ a b [1]
  4. ^ http://fac.clsu.edu.ph/
  5. ^ http://www.aquaticcommunity.com/tilapia/red.php
  6. ^ Management Guidelines of Red Tilapia Culture in Cages, Trang Province (Thai)
  7. ^ Recipes for Thaptim Fish
  8. ^ Fish breeding in Thailand
  9. ^ Kingdon, Jonathan (1989). Island Africa: The Evolution of Africa's Rare Plants and Animals. Princeton, New Jersey: Princeton University Press. pp. 221–222. ISBN 0-691-08560-9. 
  10. ^ .(Nagl et al. 2001)
  11. ^ "Nile Tilapia can fight malaria mosquitoes", BBC News, 8 August 2007.

References [edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2005). "Oreochromis niloticus" in FishBase. November 2005 version.
  • "Oreochromis niloticus". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  • Bardach, J.E.; Ryther, J.H. & McLarney, W.O. (1972): Aquaculture. the Farming and Husbandry of Freshwater and Marine Organisms. John Wiley & Sons.
  • Nagl, Sandra; Tichy, Herbert; Mayer, Werner E.; Samonte, Irene E.; McAndrew, Brendan J. & Klein, Jan (2001): Classification and Phylogenetic Relationships of African Tilapiine Fishes Inferred from Mitochondrial DNA Sequences. Molecular Phylogenetics and Evolution 20(3): 361–374. doi:10.1006/mpev.2001.0979
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!