Overview

Brief Summary

The Nile tilapia, Oreochromis niloticus, is a cichlid fish native to North, East and Central Africa, and Israel. Like other tilapia species, O. niloticus is easily and inexpensively farmed and was introduced (and subsequently established itself) in much of the tropical and subtropical world via aquaculture mainly between 1960-80 as a highly desirable alternative to the earlier (between 1940-60) introduced Mozambique tilapia O. mossambicus. Omnivorous, tolerant of wide temperature and water quality and salinity ranges, fast-breeding with an effective reproductive strategy of mouthbreeding to protect and transport its young, and difficult to eradicate, the Nile tilapia, like other tilapia species, has profoundly and negatively effected the biodiversity, ecology and water quality of many ecosystems outside its native range.

(Food and Agriculture Organization of the United Nations, factsheet; Global Invasive Species Database, Invasive Species Specialist Group (ISSG), 2008; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to tropical and subtropical Africa and the Middle East; possibly established in Lake Seminole, Florida-Georgia (Fuller et al. 1999). A breeding population has inhabited Robinson Bayou in the Pascagoula River drainage, Mississippi, since the late 1990s (Peterson et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern and eastern Africa; introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 490 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 600 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 116 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 1 - 40

Graphical representation

Depth range (m): 1 - 40
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Tilapia nilotica (Tilapia nilotica, adult) is prey of:
Homo sapiens
Actinopterygii
Aves

Based on studies in:
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)

This list may not be complete but is based on published studies.
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Tilapia nilotica (Tilapia nilotica, adult) preys on:
algae
phytoplankton

Based on studies in:
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)

This list may not be complete but is based on published studies.
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Oreochromis niloticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 168
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oreochromis niloticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 46 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGATTCTTCTCAACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACCGCGCTAAGCCTCCTAATTCGGGCAGAACTAAGCCAGCCCGGCTCTCTCCTCGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAGTACCACTCATGATTGGTGCCCCAGATATGGCCTTCCCTCGAATGAACAACATGAGTTTCTGACTCCTCCCTCCCTCATTCCTCCTCCTCCTCGCCTCATCTGGAGTCGAAGCAGGTGCCGGCACAGGGTGAACTGTTTACCCCCCGCTCGCAGGCAATCTTGCCCATGCTGGGCCTTCTGTCGACTTAACCATCTTCTCCCTCCACTTGGCCGGGGTGTCATCTATTCTAGGCGCAATTAATTTCATTACAACAATCATTAACATGAAACCCCCCGCCATCTCTCAATATCAAACACCCCTATTTGTATGGTCCGTTCTAATTACCGCAGTATTACTTCTTCTATCCCTACCCGTTCTTGCCGCCGGCATCACAATACTTCTCACAGACCGAAACCTAAACACAACCTTCTTTGATCCTGCCGGAGGAGGAGACCCCATCCTTTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTTTACATTCTTATCCTCCCCGGCTTTGGAATAATCTCCCACATTGTTGCTTACTATGCGGGTAAAAAAGAACCTTTCGGATATATGGGAATGGTCTGGGCCATGATGGCTATCGGCCTCCTAGGGTTCATTGTATGAGCCCATCACATGTTCACCGTAGGAATGGACGTAGACACACGGGCTTACTTTACTTCCGCCACAATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTGCACGGCGGTGCCATTAAATGAGAAACCCCACTCTTATGAGCGCTAGGTTTCATCTTCCTCTTTACAGTTGGAGGTCTAACCGGAATTGTCCTAGCCAATTCTTCTCTAGACATTATGCTTCACGACACATATTATGTCGTCGCCCACTTCCACTATGTCCTTTCAATAGGAGCCGTATTCGCCATCGTTGCCGGCTTCGTCCACTGATTCCCCCTATTCTCAGGATACACACTTCACGACACCTGAACTAAAATCCACTTCGGAGTTATGTTTATCGGAGTCAACCTTACTTTCTTCCCACAACATTTCCTGGGACTGGCAGGAATGCCTCGTCGGTACTCCGACTATCCCGACGCCTATACCCTTTGAAACACAGTCTCTTCTATTGGCTCAATGATCTCAATAGTCGCAGTGATTATGTTCCTATTTATTATCTGAGAAGCATTCGCCGCTAAACGAGAAGTTCTATCAGTAGAACTTACAGCAACAAACGTAGAATGACTTCACGGCTGCCCTCCTCCCTACCACACCTTCGAAGAGCCTGCCTTCGTCCAAGTTCAACAAACTTGGCTAGACTACGAAAAATCCACTACCGCCCCCTCAAAAGCCCACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nile tilapia

O. niloticus niloticus

The Nile tilapia, Oreochromis niloticus, is a species of tilapia, a cichlid fish native to Africa from Egypt south to East and Central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range (e.g. Brazil).[1] It is also commercially known as mango fish, nilotica, or boulti.[2][not in citation given] The first name leads to easy confusion with another tilapia traded commercially, the mango tilapia (Sarotherodon galilaeus).

Description[edit]

The Nile tilapia has distinctive, regular, vertical stripes extending as far down the body as the bottom edge of the caudal fin, with variable coloration. Adults reach up to 60 cm (24 in) in length and up to 4.3 kg (9.5 lb). It lives for up to 9 years. It tolerates brackish water and survives temperatures between 8 and 42 °C (46 and 108 °F). It is an omnivore, feeding on plankton as well as on higher plants. Introduced tilapia can easily become an invasive species (see Tilapia as exotic species). It is a species of high economic value and is widely introduced outside its natural range; probably next to the Mozambique tilapia (O. mossambicus), it is the most commonly cultured cichlid.[citation needed] In recent research done in Kenya, this fish has been shown to feed on mosquito larvae, making it a possible tool in the fight against malaria in Africa.[3]

Feeding behavior[edit]

The Nile tilapia is an omnivore that feeds on both plankton and aquatic plants. It generally feeds in shallow waters, as harmful gases (such as carbon dioxide, hydrogen sulfide, and ammonia) and temperature fluctuations found in deep waters create problems for the physiology of the fish. The Nile tilapia thrives on the warmer temperatures commonly found in shallow waters compared to the colder environment of the deep lake. In general, tilapias are macrophyte-feeders, feeding on a diverse range of filamentous algae and plankton.[4]

The Nile tilapia typically feeds during daytime hours. This suggests that, similar to trout and salmon, it exhibits a behavioral response to light as a main factor contributing to feeding activity. Due to their fast reproductive rate, however, overpopulation often results within groups of Nile tilapia. To obtain the necessary nutrients, night feeding may also occur due to competition for food during the daylight hours. A recent study found evidence that, contrary to popular belief, size dimorphism between the sexes results from differential food conversion efficiency rather than differential amounts of food consumed. Hence, although males and females eat equal amounts of food, males tend to grow larger due to a higher efficiency of converting food to energy.[5]

Social organization[edit]

Groups of Nile tilapia establish social hierarchies in which the dominant males have priority for both food and mating. Circular nests are built predominantly by males through mouth digging to become future spawning sites. These nests often become sites of intense courtship rituals and parental care.[6] Like other fish, the Nile tilapia travels almost exclusively in schools. Although males settle down in their crafted nesting zones, females travel between zones to find mates, resulting in competition between the males for females.

Like other tilapias, such as Mozambique tilapia, dominance between the males is established first through non-contact displays such as lateral display and tail beats. Unsuccessful attempts to reconcile the hierarchy results in contact fighting to inflict injuries. Nile tilapia has been observed to modify their fighting behavior based upon experiences during development. Thus, experience in a certain form of agonistic behavior results in differential aggressiveness among individuals.[7] Once the social hierarchy is established within a group, the dominant males enjoy the benefits of both increased access to food and an increased number of mates. However, social interactions between males in the presence of females results in higher energy expenditures as a consequence of courtship displays and sexual competition.[5]

Reproduction[edit]

Typical of most fish, the Nile tilapia reproduces through mass spawning of a brood within a nest made by the male. In such an arrangement, territoriality and sexual competition amongst the males lead to large variations in reproductive success for individuals among a group. The genetic consequence of such behavior is reduced genetic variability in the long run, as inbreeding is likely to occur among different generations due to differential male reproductive success.[8] Perhaps driven by reproductive competition, tilapias reproduce within a few months after birth. The relatively young age of sexual maturation within Nile tilapia leads to high birth and turnover rates. Consequently, the rapid reproductive rate of individuals can actually have a negative impact on growth rate, leading to the appearance of stunted tilapia as a result of a reduction in somatic growth in favor of sexual maturation.[9]

Female Nile tilapia, in the presence of other females either visually or chemically, exhibit shortened interspawning intervals. Although parental investment by a female extends the interspawning period, female tilapia that abandon their young to the care of a male gain this advantage of increased interspawning periods. One of the possible purposes behind this mechanism is to increase the reproductive advantage of females that do not have to care for young, allowing them more opportunities to spawn.[10] For males, reproductive advantage goes to the more dominant males. Studies have found that males have differential levels of gonadotropic hormones responsible for spermatogenesis, with dominant males having higher levels of the hormone. Thus, selection has favored larger sperm production with more successful males. Similarly, dominant males have both the best territory in terms of resources and the greatest access to mates.[11] Furthermore, visual communication between Nile tilapia mates both stimulates and modulates reproductive behavior between partners such as courtship, spawning frequency, and nest building.[6]

Parental care[edit]

Species belonging to the Oreochromis genus typically care for their young through mouthbrooding, oral incubation of the eggs and larvae. Similar to other tilapia, Nile tilapia are maternal mouthbrooders and extensive care is therefore provided almost exclusively by the female. After spawning in a nest made by a male, the young fry or eggs are carried in the mouth of the mother for a period of 12 days. Sometimes, the mother will push the young back into her mouth if she believes they are not ready for the outside. Nile tilapias also demonstrate parental care in times of danger. When approached by a danger, the young often swim back into the protection of their mother’s mouth.[4] However, mouthbrooding leads to significant metabolic modifications for the parents, usually the mother, as reflected by fluctuations in body weight and low fitness. Thus, parental-offspring conflict can be observed through the costs and benefits of mouthbrooding. On one hand, protection of the young ensures passage of an individual’s genes into the future generations; however, caring for the young also reduces an individual’s own reproductive fitness.[9]

As stated in the reproduction section, female Nile tilapia exhibiting parental care show extended interspawning periods. One of the benefits of this extension results in slowing down vitellogenesis (yolk deposition) to increase the survival rate of one’s own young. The size of spawned eggs correlates directly with advantages concerning hatching time, growth, survival, and onset of feeding since increased egg size means increased nutrients for the developing young. Thus, one of the reasons behind a delayed interspawning period by female Nile tilapia may be for the benefit of offspring survival.[10][12]

Aquaculture[edit]

Aquaculture of the Nile tilapia dates back to Ancient Egypt. In modern aquaculture, wild-type Nile tilapia are not farmed very often because of the dark color of their flesh, that is undesirable for many customers, and because of the reputation the fish has as being a trash fish.[13] However, they are fast-growing and produce good fillets; leucistic ("red") breeds which have lighter meat have been developed to counter the consumer distaste for darker meat.

Hybrid stock is also used in aquaculture; Nile × blue tilapia hybrids are usually rather dark, but a light-colored hybrid breed known as "Rocky Mountain White" tilapia is often grown due to its very light flesh and tolerance of low temperatures.[13]

The Nile tilapia has recently been discovered in a small stream in central Arkansas. This invasive species may harm the other aquatic life present in this stream within the next few years, depending on how quickly it is able to reproduce and how adapted it is to competition with other aquatic vertebrates. Evidence supports the possibility that the Nile tilapia has established a strong breeding ground and will eventually endanger other fish species, possibly competitively exclude them.

As food[edit]

Live pla nin on a table at a Thai market

The red-hybrid Nile tilapia is known in the Thai language as pla thapthim (Thai: ปลาทับทิม), meaning "pomegranate fish" or "ruby fish".[14] This type of tilapia is very popular in Thai cuisine where it is prepared in a variety of ways.[15]

The black and white striped tilapia pla nin (Thai: ปลานิล), meaning "black fish" and named after the Nile, is commonly either salted and grilled or deep-fried, and it can also be steamed with lime (pla nin nueng manao).[16]

Nile tilapia, called بلطي bulṭī in Arabic, is (being native to Egypt) among the most common fish in Egyptian cuisine, and probably the most common in regions far from the coast. It is generally either battered and pan-fried whole (بلطي مقلي bulṭī maqlī [bʊltˤiː maʔliː]) or grilled whole (بلطي مشوي bulṭī mashwī [bʊltˤiː maʃwiː]). Like other fish in Egypt, is generally served with rice cooked with onions and other seasonings to turn it red.

Other uses[edit]

In recent research done in Kenya, this fish has been shown to feed on mosquito larvae, making it a possible tool in the fight against malaria in Africa.[3]

Subspecies[edit]

  • Baringo tilapia, O. n. baringoensis Trewavas, 1983
  • O. n. cancellatus[verification needed] (Nichols, 1923)
  • O. n. eduardianus[verification needed] (Boulenger, 1912)
  • O. n. filoa Trewavas, 1983
  • O. n. niloticus (Linnaeus, 1758)
  • O. n. sugutae Trewavas, 1983
  • O. n. tana Seyoum & Kornfield, 1992
  • O. n. vulcani[17] (Trewavas, 1933)

The forms referred to as Oreochromis (or Tilapia) nyabikere and kabagole seem to belong to this species, too. An undescribed population found at, for example, Wami River, Lake Manyara, and Tingaylanda seems to be a close relative.[18]

See also[edit]

References[edit]

  1. ^ Azevedo-Santos, V.M.; O. Rigolin-Sá; and F.M. Pelicice (2011). "Growing, losing or introducing? Cage aquaculture as a vector for the introduction of non-native fish in Furnas Reservoir, Minas Gerais, Brazil". Neotropical Ichthyology 9: 915–919. doi:10.1590/S1679-62252011000400024. 
  2. ^ Nile Tilapia. Seafood Portal.
  3. ^ a b "Nile tilapia can fight malaria mosquitoes", BBC News, 8 August 2007.
  4. ^ a b "Oreochromis niloticus (Nile tilapia)". UWI. 
  5. ^ a b TOGUYENI, A; FAUCONNEAU, B; BOUJARD, T; FOSTIER, A; KUHN, E; MOL, K; BAROILLER, J (1 August 1997). "Feeding behaviour and food utilisation in tilapia, Oreochromis Niloticus: Effect of sex ratio and relationship with the endocrine status". Physiology & Behavior 62 (2): 273–279. doi:10.1016/S0031-9384(97)00114-5. 
  6. ^ a b Castro, A.L.S.; Gonçalves-de-Freitas, E.; Volpato, G.L.; Oliveira, C. (1 April 2009). "Visual communication stimulates reproduction in Nile tilapia, Oreochromis niloticus (L.)". Brazilian Journal of Medical and Biological Research 42 (4): 368–374. doi:10.1590/S0100-879X2009000400009. 
  7. ^ Barki, Assaf; Gilson L. Volpato (October 1998). "Early social environment and the fighting behaviour of young Oreochromis niloticus (Pisces, Cichlidae)". Behaviour 135 (7): 913–929. doi:10.1163/156853998792640332. 
  8. ^ Fessehaye, Yonas; El-bialy, Zizy; Rezk, Mahmoud A.; Crooijmans, Richard; Bovenhuis, Henk; Komen, Hans (15 June 2006). "Mating systems and male reproductive success in Nile tilapia (Oreochromis niloticus) in breeding hapas: A microsatellite analysis". Aquaculture 256 (1-4): 148–158. doi:10.1016/j.aquaculture.2006.02.024. 
  9. ^ a b Peña-Mendoza, B.; J. L. Gómez-Márquez; I. H. Salgado-Ugarte; D. Ramírez-Noguera (September 2005). "Reproductive biology of Oreochromis niloticus (Perciformes: Cichlidae) at Emiliano Zapata dam, Morelos, Mexico". Revista de Biología Tropical 53 (3/4): 515–522. 
  10. ^ a b Tacon, P.; Ndiaye, P.; Cauty, C.; Le Menn, F.; Jalabert, B. (1 November 1996). "Relationships between the expression of maternal behaviour and ovarian development in the mouthbrooding cichlid fish Oreochromis Niloticus". Aquaculture 146 (3-4): 261–275. doi:10.1016/S0044-8486(96)01389-0. 
  11. ^ Pfennig, F.; Kurth, T.; Meissner, S.; Standke, A.; Hoppe, M.; Zieschang, F.; Reitmayer, C.; Gobel, A.; Kretzschmar, G.; Gutzeit, H. O. (26 October 2011). "The social status of the male Nile tilapia (Oreochromis niloticus) influences testis structure and gene expression". Reproduction 143 (1): 71–84. doi:10.1530/REP-11-0292. 
  12. ^ Rana, Kausik J. (1986). "Parental influences on egg quality, fry production and fry performance in Oreochromis niloticus (Linnaeus) and O. mossambicus (Peters)". University of Stirling. 
  13. ^ a b [1]
  14. ^ Management Guidelines of Red Tilapia Culture in Cages, Trang Province (Thai)
  15. ^ Recipes for Thaptim Fish
  16. ^ Fish breeding in Thailand
  17. ^ Kingdon, Jonathan (1989). Island Africa: The Evolution of Africa's Rare Plants and Animals. Princeton, New Jersey: Princeton University Press. pp. 221–222. ISBN 0-691-08560-9. 
  18. ^ .(Nagl et al. 2001)

Further reading[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2005). "Oreochromis niloticus" in FishBase. November 2005 version.
  • "Oreochromis niloticus". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  • Bardach, J.E.; Ryther, J.H. & McLarney, W.O. (1972): Aquaculture. the Farming and Husbandry of Freshwater and Marine Organisms. John Wiley & Sons.
  • Nagl, Sandra; Tichy, Herbert; Mayer, Werner E.; Samonte, Irene E.; McAndrew, Brendan J. & Klein, Jan (2001): Classification and Phylogenetic Relationships of African Tilapiine Fishes Inferred from Mitochondrial DNA Sequences. Molecular Phylogenetics and Evolution 20(3): 361–374. doi:10.1006/mpev.2001.0979
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!