Overview

Brief Summary

The Nile tilapia, Oreochromis niloticus, is a cichlid fish native to North, East and Central Africa, and Israel. Like other tilapia species, O. niloticus is easily and inexpensively farmed and was introduced (and subsequently established itself) in much of the tropical and subtropical world via aquaculture mainly between 1960-80 as a highly desirable alternative to the earlier (between 1940-60) introduced Mozambique tilapia O. mossambicus. Omnivorous, tolerant of wide temperature and water quality and salinity ranges, fast-breeding with an effective reproductive strategy of mouthbreeding to protect and transport its young, and difficult to eradicate, the Nile tilapia, like other tilapia species, has profoundly and negatively effected the biodiversity, ecology and water quality of many ecosystems outside its native range.

(Food and Agriculture Organization of the United Nations, factsheet; Global Invasive Species Database, Invasive Species Specialist Group (ISSG), 2008; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Occur in a wide variety of freshwater habitats like rivers, lakes, sewage canals and irrigation channels (Ref. 28714). Mainly diurnal. Feed mainly on phytoplankton or benthic algae. Oviparous (Ref. 205). Mouthbrooding by females (Ref. 2). Extended temperature range 8-42 °C, natural temperature range 13.5 - 33 °C (Ref. 3). Marketed fresh and frozen (Ref. 9987).
  • Trewavas, E. 1983 Tilapiine fishes of the genera Sarotherodon, Oreochromis and Danakilia. British Mus. Nat. Hist., London, UK. 583 p. (Ref. 2)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Africa: naturally occurring in coastal rivers of Israel (Ref. 5166), Nile basin (including lake Albert, Edward and Tana), Jebel Marra, Lake Kivu, Lake Tanganyika, Awash River, various Ethiopian lakes, Omo River system, Lake Turkana, Suguta River and Lake Baringo (Ref. 2). In West Africa natural distribution covers the basins of the Senegal, Gambia, Volta, Niger, Benue and Chad, with introduced specimens reported from various coastal basins (Ref. 53405). Widely introduced for aquaculture, with many existing strains. Several countries report adverse ecological impact after introduction. The following subspecies were previously recognized: Oreochromis niloticus baringoensis, Oreochromis niloticus cancellatus, Oreochromis niloticus eduardianus, Oreochromis niloticus filoa, Oreochromis niloticus niloticus, Oreochromis niloticus sugutae, Oreohromis niloticus tana and Oreohromis niloticus vulcani.
  • Trewavas, E. and G.G. Teugels 1991 Oreochromis. p. 307-346. In J. Daget, J.-P. Gosse, G.G. Teugels and D.F.E. Thys van den Audenaerde (eds.) Checklist of the freshwater fishes of Africa (CLOFFA). ISNB, Brussels; MRAC, Tervuren; and ORSTOM, Paris. Vol. 4. (Ref. 5166)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to tropical and subtropical Africa and the Middle East; possibly established in Lake Seminole, Florida-Georgia (Fuller et al. 1999). A breeding population has inhabited Robinson Bayou in the Pascagoula River drainage, Mississippi, since the late 1990s (Peterson et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern and eastern Africa; introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 15 - 18; Dorsal soft rays (total): 11 - 13; Analspines: 3; Analsoft rays: 9 - 11; Vertebrae: 30 - 32
  • Trewavas, E. 1983 Tilapiine fishes of the genera Sarotherodon, Oreochromis and Danakilia. British Mus. Nat. Hist., London, UK. 583 p. (Ref. 2)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

60.0 cm SL (male/unsexed; (Ref. 4967)); max. published weight: 4,324 g (Ref. 40637); max. reported age: 9 years (Ref. 164)
  • Eccles, D.H. 1992 FAO species identification sheets for fishery purposes. Field guide to the freshwater fishes of Tanzania. Prepared and published with the support of the United Nations Development Programme (project URT/87/016). FAO, Rome. 145 p. (Ref. 4967)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Noakes, D.G.L. and E.K. Balon 1982 Life histories of tilapias: an evolutionary perspective. p. 61-82. In R.S.V. Pullin and R.H. Lowe-McConnell (eds.) The biology and culture of tilapias. ICLARM Conf. Proc. 7. (Ref. 164)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 490 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 600 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 116 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: jaws of mature male not greatly enlarged (length of lower jaw 29-37 % of head length); genital papilla of breeding male not tassellated (Ref. 2). Most distinguishing characteristic is the presence of regular vertical stripes throughout depth of caudal fin (Ref. 4967, 53405).Description: lower pharyngeal bone longer than broad, its anterior part longer than toothed part; outer jaw teeth bicuspid, inner jaw teeth tricuspid, posterior pharyngeal teeth bicuspid and stout; 3-4 rows of teeth in jaws (3-5, rarely 6, in specimens over 200 mm SL); micro-gillrakers present; scales cycloid (Ref. 53405).Coloration: margin of dorsal fin grey or black; vertical bars in caudal fin 7-12 (Ref. 2). Regular black cross bars on caudal fin; ground colour greyish, relatively dark in adults; back olivaceous-green, sides paler, with 6-9 rather indistinct cross bars; belly whitish; upper lip pale green or white, lower lip white; dorsal and anal fins greyish, sometimes with very narrow red margin, soft part of fin with vertical lines (or with aligned light spots resembling striped pattern); pelvic fins grey, pectorals transparent; "tilapian" spot lacking in adults but very distinct in fingerlings which also have more distinct cross bars and very prominent black spot on upper part of caudal peduncle; throat, belly and unpaired fins black in mature males (Ref. 53405).
  • Trewavas, E. 1983 Tilapiine fishes of the genera Sarotherodon, Oreochromis and Danakilia. British Mus. Nat. Hist., London, UK. 583 p. (Ref. 2)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; brackish; depth range 0 - 6 m (Ref. 32849), usually ? - 20 m (Ref. 34290)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Wudneh, T. 1998 Biology and management of fish stocks in Bahir Dar Gulf, Lake Tana, Ethiopia. Wageningen Agricultural University, The Netherlands. 144 p. Ph. D. dissertation. (Ref. 32849)
  • van Oijen, M.J.P. 1995 Appendix I. Key to Lake Victoria fishes other than haplochromine cichlids. p. 209-300. In F. Witte and W.L.T. van Densen (eds.) Fish stocks and fisheries of Lake Victoria. A handbook for field observations. Samara Publishing Limited, Dyfed, Great Britain. (Ref. 34290)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 1 - 40

Graphical representation

Depth range (m): 1 - 40
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabit the littoral zone of lakes and are abundant in Lakes Turkana (Rudolf) and Albert. Although a freshwater species they are also found in brackish water like in the Nile Delta. The area occupied by the species extends from 8° S to 32° N and from 6000 ft (1830 m) to sea level. O. niloticus of Lake Edward form very large schools of 100 sq.m or more at the lake surface when feeding. The species takes epiphytic algae, diatoms or plankton according to conditions. (See also Ref. 3736).
  • Philippart, J.-C. and J.-C. Ruwet 1982 Ecology and distribution of tilapias. p. 15-60. In R.S.V. Pullin and R.H. Lowe-McConnell (eds.) The biology and culture of tilapias. ICLARM Conf. Proc. 7. (Ref. 3)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Tilapia nilotica (Tilapia nilotica, adult) is prey of:
Homo sapiens
Actinopterygii
Aves

Based on studies in:
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)

This list may not be complete but is based on published studies.
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Tilapia nilotica (Tilapia nilotica, adult) preys on:
algae
phytoplankton

Based on studies in:
Uganda (Lake or pond)
Uganda, Lake George (Lake or pond)

This list may not be complete but is based on published studies.
  • D. J. W. Moriarty, J. P. E. C. Darlington, I. G. Dunn, C. M. Moriarty and M. P. Tevlin, Feeding and grazing in Lake George, Uganda, Proc. Roy. Soc. B. 184:299-319 (1973).
  • M. J. Burgis, I. G. Dunn, G. G. Ganf, L. M. McGowan and A. B. Viner, Lake George, Uganda: Studies on a tropical freshwater ecosystem. In: Productivity Problems of Freshwaters, Z. Kajak and A. Hillbricht-Ilkowska, Eds. (Polish Scientific, Warsaw, 1972), p
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Yellow Grub. Parasitic infestations (protozoa, worms, etc.)
  • Kabata, Z. 1985 Parasites and diseases of fish cultured in the tropics. Taylor and Francis Ltd., London, UK. 318 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whirling Viral Disease of Tilapia Larvae. Viral diseases
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Turbidity of the Skin (Freshwater fish). Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trypanosoma Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Baker, J.R. 1960 Trypanosomes and dactylosomes from the blood of fresh-water fish in East-Africa. Parasitology 50:515-526. (Ref. 52501)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trypanosoma Infection. Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tripartiella Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tripartiella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
  • Nguenga, D. 1988 A note on infestation of Oreochromis niloticus with Trichodina sp. and Dactylogyrus sp. p. 117-119. In R.S.V. Pullin, T. Bhukaswan, K. Tonguthai and J.L. Maclean (eds.) The Second International Symposium on Tilapia in Aquaculture. ICLARM Conf. Proc. 15, 623 p. Dept. of Fish., Bangkok, Thailand and ICLARM, Manila, Philippines. (Ref. 176)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infestation 9. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infestation 8. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infestation 10. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 5. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 1. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transversotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sporozoa-infection (Myxobolus sp.). Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myxobacterial Infections. Bacterial diseases
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lamproglena Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Iridovirosis. Viral diseases
  • McGrogan, D.G., V.E. Ostaland, P.J. Byrne and H.W. Ferguson 1998 Systemic disease involving an iridovirus-like agent in cultured tilapia, Oreochromis niloticus L. - a case report. J. Fish Dis. 21:149-152. (Ref. 47596)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ichthyophthirius Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gyrodactylus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gyrodactylus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gnathostoma Disease (larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish Tuberculosis 2. Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish tuberculosis (FishMB). Bacterial diseases
  • Roberts, R.J. and C. Sommerville 1982 Diseases of tilapias. p. 247-263. In R.S.V. Pullin and R.H. Lowe-McConnell (eds.) The biology and culture of tilapias. ICLARM Conf. Proc. 7. (Ref. 82)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and A.B.A. Ahmed 2002 Checklist of the parasites of fishes of Bangladesh. FAO Fish. Tech. Paper (T369/1), 77 p. (Ref. 42533)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

False Fungal Infection (Epistylis sp.). Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

False Fungal Infection (Apiosoma sp.). Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ergasilus Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
  • Lannan, C.N., J.L. Batholomew and J.L. Fryer 1999 Chlamydial infections of fish: Epitheliocystis. p.255-267. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders Vol. 3: Viral, bacterial and fungal infections. CABI Int'l. (Ref. 48851)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enterogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
  • Plumb, J.A. 1999 Edwardsiella Septicaemias. p.479-521. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dilepid Cestode larvae Infestation (general sp.). Parasitic infestations (protozoa, worms, etc.)
  • Khalil, L.F. and J.P. Thurston 1973 Studies on the helminth parasites of freshwater fishes of Uganda including the descriptions of two new species of digeneans. Rev. Zool. Bot. afr. 87(2):209-248. (Ref. 52494)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dactylosoma Infection 1. Parasitic infestations (protozoa, worms, etc.)
  • Baker, J.R. 1960 Trypanosomes and dactylosomes from the blood of fresh-water fish in East-Africa. Parasitology 50:515-526. (Ref. 52501)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
  • Nguenga, D. 1988 A note on infestation of Oreochromis niloticus with Trichodina sp. and Dactylogyrus sp. p. 117-119. In R.S.V. Pullin, T. Bhukaswan, K. Tonguthai and J.L. Maclean (eds.) The Second International Symposium on Tilapia in Aquaculture. ICLARM Conf. Proc. 15, 623 p. Dept. of Fish., Bangkok, Thailand and ICLARM, Manila, Philippines. (Ref. 176)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cryptobia Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cristaria Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Contracaecum Disease (larvae). Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Infestation 4. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Infestation 10. Parasitic infestations (protozoa, worms, etc.)
  • Khalil, L.F. and J.P. Thurston 1973 Studies on the helminth parasites of freshwater fishes of Uganda including the descriptions of two new species of digeneans. Rev. Zool. Bot. afr. 87(2):209-248. (Ref. 52494)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cichlidogyrus Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caligus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amplicaecum Infection (Larvae). Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alitropus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aeromonosis. Bacterial diseases
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aeromonasis in Tilapia. Bacterial diseases
  • Wada, K. 1990 Aeromonas infectious disease of Oreochromis niloticus. J. Yoshoku-Disease Leaflet No. 146. (Ref. 4869)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Acanthogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Khalil, L.F. and J.P. Thurston 1973 Studies on the helminth parasites of freshwater fishes of Uganda including the descriptions of two new species of digeneans. Rev. Zool. Bot. afr. 87(2):209-248. (Ref. 52494)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Sexual maturity is reached at 3-6 months depending on temperature, reaching about 30 g. Reproduction occurs only when temperatures are over 20°C. Several yearly spawnings every 30 days. Females incubate eggs inside their mouths (approximately for a week) where larvae hatch and remain until the vitellus is reabsorved. Egg size 1.5 mm, larval length at hatching 4 mm.Spawns in firm sand in water from 0.6 to 2 m deep of lakes. Males set up and defend territory which are visited by the females. Courtship lasts several hours. Eggs are shed in batches in shallow nest and fertilized by male. Each batch of eggs is picked up into oral cavity by female. Females solely involved in broodcare. Female carries up to 200 eggs in her mouth where the larvae hatch and remain until after the yolk-sac is absorbed.
  • Trewavas, E. 1983 Tilapiine fishes of the genera Sarotherodon, Oreochromis and Danakilia. British Mus. Nat. Hist., London, UK. 583 p. (Ref. 2)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreochromis niloticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 46 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGATTCTTCTCAACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACCGCGCTAAGCCTCCTAATTCGGGCAGAACTAAGCCAGCCCGGCTCTCTCCTCGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAGTACCACTCATGATTGGTGCCCCAGATATGGCCTTCCCTCGAATGAACAACATGAGTTTCTGACTCCTCCCTCCCTCATTCCTCCTCCTCCTCGCCTCATCTGGAGTCGAAGCAGGTGCCGGCACAGGGTGAACTGTTTACCCCCCGCTCGCAGGCAATCTTGCCCATGCTGGGCCTTCTGTCGACTTAACCATCTTCTCCCTCCACTTGGCCGGGGTGTCATCTATTCTAGGCGCAATTAATTTCATTACAACAATCATTAACATGAAACCCCCCGCCATCTCTCAATATCAAACACCCCTATTTGTATGGTCCGTTCTAATTACCGCAGTATTACTTCTTCTATCCCTACCCGTTCTTGCCGCCGGCATCACAATACTTCTCACAGACCGAAACCTAAACACAACCTTCTTTGATCCTGCCGGAGGAGGAGACCCCATCCTTTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTTTACATTCTTATCCTCCCCGGCTTTGGAATAATCTCCCACATTGTTGCTTACTATGCGGGTAAAAAAGAACCTTTCGGATATATGGGAATGGTCTGGGCCATGATGGCTATCGGCCTCCTAGGGTTCATTGTATGAGCCCATCACATGTTCACCGTAGGAATGGACGTAGACACACGGGCTTACTTTACTTCCGCCACAATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTGCACGGCGGTGCCATTAAATGAGAAACCCCACTCTTATGAGCGCTAGGTTTCATCTTCCTCTTTACAGTTGGAGGTCTAACCGGAATTGTCCTAGCCAATTCTTCTCTAGACATTATGCTTCACGACACATATTATGTCGTCGCCCACTTCCACTATGTCCTTTCAATAGGAGCCGTATTCGCCATCGTTGCCGGCTTCGTCCACTGATTCCCCCTATTCTCAGGATACACACTTCACGACACCTGAACTAAAATCCACTTCGGAGTTATGTTTATCGGAGTCAACCTTACTTTCTTCCCACAACATTTCCTGGGACTGGCAGGAATGCCTCGTCGGTACTCCGACTATCCCGACGCCTATACCCTTTGAAACACAGTCTCTTCTATTGGCTCAATGATCTCAATAGTCGCAGTGATTATGTTCCTATTTATTATCTGAGAAGCATTCGCCGCTAAACGAGAAGTTCTATCAGTAGAACTTACAGCAACAAACGTAGAATGACTTCACGGCTGCCCTCCTCCCTACCACACCTTCGAAGAGCCTGCCTTCGTCCAAGTTCAACAAACTTGGCTAGACTACGAAAAATCCACTACCGCCCCCTCAAAAGCCCACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oreochromis niloticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 168
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nile tilapia

O. niloticus niloticus
An Egyptian New Kingdom amulet in the shape of a Tilapia hieroglyph from c. 1350/1320 BCE

The Nile tilapia, Oreochromis niloticus, is a species of tilapia, a cichlid fish native to Africa from Egypt south to East and Central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range (e.g. Brazil).[1] It is also commercially known as mango fish, nilotica, or boulti.[2][not in citation given] The first name leads to easy confusion with another tilapia traded commercially, the mango tilapia (Sarotherodon galilaeus).

Description[edit]

The Nile tilapia has distinctive, regular, vertical stripes extending as far down the body as the bottom edge of the caudal fin, with variable coloration. Adults reach up to 60 cm (24 in) in length and up to 4.3 kg (9.5 lb). It lives for up to 9 years. It tolerates brackish water and survives temperatures between 8 and 42 °C (46 and 108 °F). It is an omnivore, feeding on plankton as well as on higher plants. Introduced tilapia can easily become an invasive species (see Tilapia as exotic species). It is a species of high economic value and is widely introduced outside its natural range; probably next to the Mozambique tilapia (O. mossambicus), it is the most commonly cultured cichlid.[citation needed] In recent research done in Kenya, this fish has been shown to feed on mosquito larvae, making it a possible tool in the fight against malaria in Africa.[3]

Feeding behavior[edit]

The Nile tilapia is an omnivore that feeds on both plankton and aquatic plants. It generally feeds in shallow waters, as harmful gases (such as carbon dioxide, hydrogen sulfide, and ammonia) and temperature fluctuations found in deep waters create problems for the physiology of the fish. The Nile tilapia thrives on the warmer temperatures commonly found in shallow waters compared to the colder environment of the deep lake. In general, tilapias are macrophyte-feeders, feeding on a diverse range of filamentous algae and plankton.[4]

The Nile tilapia typically feeds during daytime hours. This suggests that, similar to trout and salmon, it exhibits a behavioral response to light as a main factor contributing to feeding activity. Due to their fast reproductive rate, however, overpopulation often results within groups of Nile tilapia. To obtain the necessary nutrients, night feeding may also occur due to competition for food during the daylight hours. A recent study found evidence that, contrary to popular belief, size dimorphism between the sexes results from differential food conversion efficiency rather than differential amounts of food consumed. Hence, although males and females eat equal amounts of food, males tend to grow larger due to a higher efficiency of converting food to energy.[5]

Social organization[edit]

Groups of Nile tilapia establish social hierarchies in which the dominant males have priority for both food and mating. Circular nests are built predominantly by males through mouth digging to become future spawning sites. These nests often become sites of intense courtship rituals and parental care.[6] Like other fish, the Nile tilapia travels almost exclusively in schools. Although males settle down in their crafted nesting zones, females travel between zones to find mates, resulting in competition between the males for females.

Like other tilapias, such as Mozambique tilapia, dominance between the males is established first through non-contact displays such as lateral display and tail beats. Unsuccessful attempts to reconcile the hierarchy results in contact fighting to inflict injuries. Nile tilapia has been observed to modify their fighting behavior based upon experiences during development. Thus, experience in a certain form of agonistic behavior results in differential aggressiveness among individuals.[7] Once the social hierarchy is established within a group, the dominant males enjoy the benefits of both increased access to food and an increased number of mates. However, social interactions between males in the presence of females results in higher energy expenditures as a consequence of courtship displays and sexual competition.[5]

Reproduction[edit]

Typical of most fish, the Nile tilapia reproduces through mass spawning of a brood within a nest made by the male. In such an arrangement, territoriality and sexual competition amongst the males lead to large variations in reproductive success for individuals among a group. The genetic consequence of such behavior is reduced genetic variability in the long run, as inbreeding is likely to occur among different generations due to differential male reproductive success.[8] Perhaps driven by reproductive competition, tilapias reproduce within a few months after birth. The relatively young age of sexual maturation within Nile tilapia leads to high birth and turnover rates. Consequently, the rapid reproductive rate of individuals can actually have a negative impact on growth rate, leading to the appearance of stunted tilapia as a result of a reduction in somatic growth in favor of sexual maturation.[9]

Female Nile tilapia, in the presence of other females either visually or chemically, exhibit shortened interspawning intervals. Although parental investment by a female extends the interspawning period, female tilapia that abandon their young to the care of a male gain this advantage of increased interspawning periods. One of the possible purposes behind this mechanism is to increase the reproductive advantage of females that do not have to care for young, allowing them more opportunities to spawn.[10] For males, reproductive advantage goes to the more dominant males. Studies have found that males have differential levels of gonadotropic hormones responsible for spermatogenesis, with dominant males having higher levels of the hormone. Thus, selection has favored larger sperm production with more successful males. Similarly, dominant males have both the best territory in terms of resources and the greatest access to mates.[11] Furthermore, visual communication between Nile tilapia mates both stimulates and modulates reproductive behavior between partners such as courtship, spawning frequency, and nest building.[6]

Parental care[edit]

Species belonging to the Oreochromis genus typically care for their young through mouthbrooding, oral incubation of the eggs and larvae. Similar to other tilapia, Nile tilapia are maternal mouthbrooders and extensive care is therefore provided almost exclusively by the female. After spawning in a nest made by a male, the young fry or eggs are carried in the mouth of the mother for a period of 12 days. Sometimes, the mother will push the young back into her mouth if she believes they are not ready for the outside. Nile tilapias also demonstrate parental care in times of danger. When approached by a danger, the young often swim back into the protection of their mother’s mouth.[4] However, mouthbrooding leads to significant metabolic modifications for the parents, usually the mother, as reflected by fluctuations in body weight and low fitness. Thus, parental-offspring conflict can be observed through the costs and benefits of mouthbrooding. On one hand, protection of the young ensures passage of an individual’s genes into the future generations; however, caring for the young also reduces an individual’s own reproductive fitness.[9]

As stated in the reproduction section, female Nile tilapia exhibiting parental care show extended interspawning periods. One of the benefits of this extension results in slowing down vitellogenesis (yolk deposition) to increase the survival rate of one’s own young. The size of spawned eggs correlates directly with advantages concerning hatching time, growth, survival, and onset of feeding since increased egg size means increased nutrients for the developing young. Thus, one of the reasons behind a delayed interspawning period by female Nile tilapia may be for the benefit of offspring survival.[10][12]

Aquaculture[edit]

Aquaculture of the Nile tilapia dates back to Ancient Egypt. In modern aquaculture, wild-type Nile tilapia are not farmed very often because of the dark color of their flesh, that is undesirable for many customers, and because of the reputation the fish has as being a trash fish.[13] However, they are fast-growing and produce good fillets; leucistic ("red") breeds which have lighter meat have been developed to counter the consumer distaste for darker meat.

Hybrid stock is also used in aquaculture; Nile × blue tilapia hybrids are usually rather dark, but a light-colored hybrid breed known as "Rocky Mountain White" tilapia is often grown due to its very light flesh and tolerance of low temperatures.[13]

The Nile tilapia has recently been discovered in a small stream in central Arkansas. This invasive species may harm the other aquatic life present in this stream within the next few years, depending on how quickly it is able to reproduce and how adapted it is to competition with other aquatic vertebrates. Evidence supports the possibility that the Nile tilapia has established a strong breeding ground and will eventually endanger other fish species, possibly competitively exclude them.

As food[edit]

Live pla nin on a table at a Thai market

The red-hybrid Nile tilapia is known in the Thai language as pla thapthim (Thai: ปลาทับทิม), meaning "pomegranate fish" or "ruby fish".[14] This type of tilapia is very popular in Thai cuisine where it is prepared in a variety of ways.[15]

The black and white striped tilapia pla nin (Thai: ปลานิล), meaning "black fish" and named after the Nile, is commonly either salted and grilled or deep-fried, and it can also be steamed with lime (pla nin nueng manao).[16]

Nile tilapia, called بلطي bulṭī in Arabic, is (being native to Egypt) among the most common fish in Egyptian cuisine, and probably the most common in regions far from the coast. It is generally either battered and pan-fried whole (بلطي مقلي bulṭī maqlī [bʊltˤiː maʔliː]) or grilled whole (بلطي مشوي bulṭī mashwī [bʊltˤiː maʃwiː]). Like other fish in Egypt, is generally served with rice cooked with onions and other seasonings to turn it red.

Other uses[edit]

In recent research done in Kenya, this fish has been shown to feed on mosquito larvae, making it a possible tool in the fight against malaria in Africa.[3]

Subspecies[edit]

  • Baringo tilapia, O. n. baringoensis Trewavas, 1983
  • O. n. cancellatus[verification needed] (Nichols, 1923)
  • O. n. eduardianus[verification needed] (Boulenger, 1912)
  • O. n. filoa Trewavas, 1983
  • O. n. niloticus (Linnaeus, 1758)
  • O. n. sugutae Trewavas, 1983
  • O. n. tana Seyoum & Kornfield, 1992
  • O. n. vulcani[17] (Trewavas, 1933)

The forms referred to as Oreochromis (or Tilapia) nyabikere and kabagole seem to belong to this species, too. An undescribed population found at, for example, Wami River, Lake Manyara, and Tingaylanda seems to be a close relative.[18]

See also[edit]

References[edit]

  1. ^ Azevedo-Santos, V.M.; O. Rigolin-Sá; and F.M. Pelicice (2011). "Growing, losing or introducing? Cage aquaculture as a vector for the introduction of non-native fish in Furnas Reservoir, Minas Gerais, Brazil". Neotropical Ichthyology 9: 915–919. doi:10.1590/S1679-62252011000400024. 
  2. ^ Nile Tilapia. Seafood Portal.
  3. ^ a b "Nile tilapia can fight malaria mosquitoes", BBC News, 8 August 2007.
  4. ^ a b "Oreochromis niloticus (Nile tilapia)". UWI. 
  5. ^ a b TOGUYENI, A; FAUCONNEAU, B; BOUJARD, T; FOSTIER, A; KUHN, E; MOL, K; BAROILLER, J (1 August 1997). "Feeding behaviour and food utilisation in tilapia, Oreochromis Niloticus: Effect of sex ratio and relationship with the endocrine status". Physiology & Behavior 62 (2): 273–279. doi:10.1016/S0031-9384(97)00114-5. 
  6. ^ a b Castro, A.L.S.; Gonçalves-de-Freitas, E.; Volpato, G.L.; Oliveira, C. (1 April 2009). "Visual communication stimulates reproduction in Nile tilapia, Oreochromis niloticus (L.)". Brazilian Journal of Medical and Biological Research 42 (4): 368–374. doi:10.1590/S0100-879X2009000400009. 
  7. ^ Barki, Assaf; Gilson L. Volpato (October 1998). "Early social environment and the fighting behaviour of young Oreochromis niloticus (Pisces, Cichlidae)". Behaviour 135 (7): 913–929. doi:10.1163/156853998792640332. 
  8. ^ Fessehaye, Yonas; El-bialy, Zizy; Rezk, Mahmoud A.; Crooijmans, Richard; Bovenhuis, Henk; Komen, Hans (15 June 2006). "Mating systems and male reproductive success in Nile tilapia (Oreochromis niloticus) in breeding hapas: A microsatellite analysis". Aquaculture 256 (1-4): 148–158. doi:10.1016/j.aquaculture.2006.02.024. 
  9. ^ a b Peña-Mendoza, B.; J. L. Gómez-Márquez; I. H. Salgado-Ugarte; D. Ramírez-Noguera (September 2005). "Reproductive biology of Oreochromis niloticus (Perciformes: Cichlidae) at Emiliano Zapata dam, Morelos, Mexico". Revista de Biología Tropical 53 (3/4): 515–522. 
  10. ^ a b Tacon, P.; Ndiaye, P.; Cauty, C.; Le Menn, F.; Jalabert, B. (1 November 1996). "Relationships between the expression of maternal behaviour and ovarian development in the mouthbrooding cichlid fish Oreochromis Niloticus". Aquaculture 146 (3-4): 261–275. doi:10.1016/S0044-8486(96)01389-0. 
  11. ^ Pfennig, F.; Kurth, T.; Meissner, S.; Standke, A.; Hoppe, M.; Zieschang, F.; Reitmayer, C.; Gobel, A.; Kretzschmar, G.; Gutzeit, H. O. (26 October 2011). "The social status of the male Nile tilapia (Oreochromis niloticus) influences testis structure and gene expression". Reproduction 143 (1): 71–84. doi:10.1530/REP-11-0292. 
  12. ^ Rana, Kausik J. (1986). "Parental influences on egg quality, fry production and fry performance in Oreochromis niloticus (Linnaeus) and O. mossambicus (Peters)". University of Stirling. 
  13. ^ a b [1]
  14. ^ Management Guidelines of Red Tilapia Culture in Cages, Trang Province (Thai)
  15. ^ Recipes for Thaptim Fish
  16. ^ Fish breeding in Thailand
  17. ^ Kingdon, Jonathan (1989). Island Africa: The Evolution of Africa's Rare Plants and Animals. Princeton, New Jersey: Princeton University Press. pp. 221–222. ISBN 0-691-08560-9. 
  18. ^ .(Nagl et al. 2001)

Further reading[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2005). "Oreochromis niloticus" in FishBase. November 2005 version.
  • "Oreochromis niloticus". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  • Bardach, J.E.; Ryther, J.H. & McLarney, W.O. (1972): Aquaculture. the Farming and Husbandry of Freshwater and Marine Organisms. John Wiley & Sons.
  • Nagl, Sandra; Tichy, Herbert; Mayer, Werner E.; Samonte, Irene E.; McAndrew, Brendan J. & Klein, Jan (2001): Classification and Phylogenetic Relationships of African Tilapiine Fishes Inferred from Mitochondrial DNA Sequences. Molecular Phylogenetics and Evolution 20(3): 361–374. doi:10.1006/mpev.2001.0979
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!