Overview

Brief Summary

Oreochromis mossambicus, commonly known as the Mozambique tilapia, blue or Kurper bream, and by many other common names, is a cichlid fish native to southern Africa. Because of its success as a food fish bred through aquaculture, O. mossambicus has been spread to tropical and subtropical countries around the world. This hardy fish tolerates wide water temperatures, has a broad, omnivorous diet, rears easily and its firm texture and mild taste make it very popular for eating. The Mozambique tilapia breeds quickly and is fecund; females protect and transport their young by mouthbrooding. Because it easily establishes itself outside of its native range O. mossambicus has become an impossible to irradicate invasive pest in many countries, damaging ecosystems and biodiversity and threatening native fish (for example the striped mullet Mugil cephalus in Hawai’i and the endangered desert pupfish Cyprinodon macularius in California’s Salton Sea. Oreochromis mossambicus (along with closely the related O. aureus, with which O. mossambicus easily hybridizes) is on the list of the world’s 100 worst invasive species put out by the Invasive Species Specialist Group. (Global Invasive Species Database, Invasive Species Specialist Group (ISSG); Nico 2012; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults thrive in standing waters (Ref. 7248, 12501). Inhabit reservoirs, rivers, creeks, drains, swamps and tidal creeks; commonly over mud bottoms, often in well-vegetated areas (Ref. 44894). Also found in warm weedy pools of sluggish streams, canals, and ponds (Ref. 5723). Most common in blind estuaries and coastal lakes (Ref. 32693), but usually absent from permanently open estuaries and open sea (Ref. 6465) and from fast-flowing waters (Ref. 7248, 12501). Normally not found at high altitudes (Ref. 6465). Able to survive extreme reduction of temporary water bodies (Ref. 2, 27445). Highly euryhaline (Ref. 2, 3, 23, 58, 61, 6465, 12501, 12522, 12524, 13337, 27445, 55352). Grow and reproduce in fresh-, brackish and seawater (Ref. 2, 21, 23, 61, 5214, 27445, 36683, 54362). Can be reared under hyper-saline conditions (Ref. 4537, 44894, 52307). Tolerate low dissolved oxygen levels (Ref. 3, 23, 6465) and can utilise atmospheric oxygen when water oxygen levels drop (Ref. 61, 6465). Mainly diurnal. May form schools (Ref. 3, 4537, 44894). Omnivorous (Ref. 21, 12524), feed mainly on algae and phytoplankton (Ref. 4537, 7248, 12501, 12522, 12524, 13337, 36683, 44894, 52307) but also take some zooplankton, small insects and their larvae (Ref. 4537, 7248, 12524, 13337, 44894, 52307), shrimps (Ref. 12524, 13337), earthworms (Ref. 12501) and aquatic macrophytes (Ref. 6465). Juveniles carnivorous/omnivorous, adults tend to be herbivorous or detritus feeders (Ref. 2, 6465, 13517). Large individuals have been reported to prey on small fishes (Ref. 2, 6465, 12501, 12522), and occasionally cannibalise their own young (Ref. 2, 6465). Exhibit considerable plasticity in their feeding habits (Ref. 6465, 13544) as well as in their reproductive biology (Ref. 13544). Polygamous (Ref. 12524, 13337), maternal mouthbrooder (Ref. 1, 5214, 12524, 13337). Reach sexual maturity at 15 centimeter length (Ref. 44894), but stunted fish may breed at 6-7 centimeters and at an age of just over 2 months (Ref. 52307). Fecundity high (Ref. 55352). Extended temperature range 8-42 °C, natural temperature range 17-35°C (Ref. 3), with salinity-dependent difference in temperature tolerance (Ref. 2, 23). Somewhat aggressive toward other species (Ref. 36683). Marketed fresh and frozen (Ref. 9987). Excellent palatability (Ref. 6465), with small head and large dress-out weight (Ref. 61), and filets without small bones (Ref. 57960). Used extensively in biological, physiological and behavioural research (Ref. 7248). Translocated and introduced for aquaculture, sport fishing, stocking man-made lakes and biological control of nuisance plants and animals (Ref. 6465). Eurytopic; a most successful and vagile invader (Ref. 6465).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Mozambique tilapia, Oreochromis mossambicus, is native to Africa but has been introduced to Florida and elsewhere as well.Individuals collected in their native range typically reach 380 mm SL (standard length, measured from the snout to the caudal peduncle), while animals collected elsewhere (e.g., the Gulf of Mexico) may reach only around 220 mm. Males grow slightly larger than females. Females and non-breeding males are mainly silver in color with 2-5 blotches along the midline and occasionally the dorsal fin. Breeding males are black with whiteMozambique tilapia have 28-31 vertebrae and 14-20 lower gill rakers. The spine/ray count is: Dorsal = XV-XVII + 26-29; Anal = III=iV + 9-10. (GSMFC, Texas State University).
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa: Lower Zambezi, Lower Shiré and coastal plains from Zambezi delta to Algoa Bay. Occurs southwards to the Brak River in the eastern Cape and in the Transvaal in the Limpopo system (Ref. 6465). Widely introduced for aquaculture, but escaped and established itself in the wild in many countries, often outcompeting local species (Ref. 12217). Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Lower Zambezi, Lower Shire and coastal plains from Zambezi delta to Algoa Bay. Occurs southwards to the Bushmans River in the eastern Cape and in the Transvaal in the Limpopo system (Skelton 2001). Widely dispersed beyond this range to inland regions and to the south west and west coastal rivers including the lower Orange and rivers of Namibia. Introduced to tropical and warm temperate localities throughout the world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Madagascar, Mozambique
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to tropical and subtropical Africa (Fuller et al. 1999). Established or locally established in Arizona, California, Colorado, Florida, Hawaii, Idaho, and Texas (now hybridized with blue tilapia, R. G. Howells, pers. comm., 2003); formerly established in additional states and reported from others (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In their native range along the eastern coast of Africa, Oreochromis mossambicus occurs in riverine and coastal lagoon habitats. The species was introduced to the U.S. by the aquarium and aquacultures trades and were released either accidentally or intentionally into waterways of Texas, Florida and Alabama (Brown 1961, Courtney et al. 1974, Bruton and Bolt 1975, Whiteside 1975, Lee et al. 1980). Riedel and Costa-Pierce (2005), describe the existence of a large southern California population of O. mossambicus within the Salton Sea and known locally as Salton Sea tilapia.Centers of abundance in Florida include Dade, Brevard, Indian River, and Hillsborough counties, and Courtney et al. (1974) suggest each of these represents an independent introduction event. Within the India River Lagoon region, Mozambique tilapia have been found in the Brevard and Indian River counties. Courtney, et al. (1974), cites these as the result of distinct introductions events.
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern Africa; Introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 15 - 18; Dorsal soft rays (total): 10 - 13; Analspines: 3; Analsoft rays: 7 - 12; Vertebrae: 28 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 390 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

39.0 cm SL (male/unsexed; (Ref. 21)); max. published weight: 1,130 g (Ref. 40637); max. reported age: 11 years (Ref. 164)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 36 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The maximum size of the Oreochromis mossambicus tends to vary based on its geographical location. Collections from within the native range indicate a maximum size of around 430 mm, while animals in the Gulf of Mexico measured a maximum of 360mm (Bruton and Allanson 1974, Lee et al, 1980).O. mossambicus are long-lived surviving to approximately 11 years (Boschung and Mayden 2004, Fryer and Illes 1972).
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: snout long; forehead with relatively large scales, starting with 2 scales between the eyes followed by 9 scales up to the dorsal fin (Ref. 3058, 3060). Adult males develop a pointed, duckbill-like snout (Ref. 52307) due to enlarged jaws, often causing the upper profile to become concave (Ref. 2, 7248, 12524, 13337, 52307), but upper profile convex in smaller specimens (Ref. 1870, 6460). Pharyngeal teeth very fine, the dentigerous area with narrow lobes, the blade in adults longer than dentigerous area; 28-31 vertebrae; 3 anal spines; 14-20 lower gill-rakers; genital papilla of males simple or with a shallow distal notch; caudal fin not densely scaled; female and non-breeding male silvery with 2-5 mid-lateral blotches and some of a more dorsal series; breeding male black with white lower parts of head and red margins to dorsal and caudal fins (Ref. 2). Description: moderately deep-bodied (Ref. 7248, 52307), but very variable according to food availability (Ref. 5214). Head profile straight in juveniles and females (Ref. 7248). Mouth large (Ref. 1870, 2989, 53262, 52307, 54167). Lower jaw prominent; lips thick (Ref. 3058, 3060). Maxillary ending between nostril and eye in females and immature males (Ref. 2), in breeding males (Ref. 2) mouth reaching to below anterior border of eye (Ref. 1870, 2989, 53262, 54167, 54759) or a little beyond (Ref. 1870, 2989, 53262, 54167). Eye with yellow ring around pupil (Ref. 57960). Otoliths: sulcus with nearly straight crista inferior at the transition between ostium and cauda (thus no ventralward widening of the ostium is present) (Ref. 56279). 2-3 series of scales on cheek (Ref. 2, 552, 1870, 2989, 3058, 3060, 6460, 53262, 54167). Scales cycloid (Ref. 1870, 2989, 3058, 4904, 5728, 53262, 54167). Scales on belly small, breast scales even smaller (Ref. 3058). Large scales on opercle (Ref. 1870, 53262), in 3 rows (Ref. 54759). 17-23 scales in upper part of lateral line, 10-17 in lower part (Ref. 1870, 2989, 3058, 54167). 9-12 predorsal scales (Ref. 57928). 15 precaudal vertebrae; 15-16 caudal vertebrae; 12-13 pairs of pleural ribs; 2 pairs of epineurals; 6 pairs of epipleurals; ventral vertebral apothysis on third vertebra (Ref. 57928). Gill-rakers short (Ref. 1870, 2989, 5214, 6465, 12524, 13337, 54167) and thick (Ref. 54167). Dorsal fin spines subequal from the sixth; dorsal soft rays a little longer than longest spines (Ref. 54167). Last dorsal spine the longest (Ref. 1870, 54167). Soft part of dorsal and anal fin long and pointed (Ref. 1870, 3058, 3060, 4904, 53262), especially in males (Ref. 44586). Dorsal fin with 25-28 pterygiophores (Ref. 57928). Pectoral fin (nearly) as long as head (Ref. 1870, 2989, 53262, 54167), pointed (Ref. 1870, 6460, 53262, 54759), reaching to vent (Ref. 6460, 54167) or to a little beyond origin of anal fin (Ref. 1870, 2989, 53262, 54167, 54759). 4-6 scales between bases of pectoral and pelvic fins (Ref. 2). Anal fin with 11-12 pterygiophores (Ref. 57928). Outer rays of pelvic fins slightly produced, reaching to vent (Ref. 1870, 54167) or beyond origin of anal (Ref. 1870, 2989). Caudal fin scaly in the basal half (Ref. 1870, 6460, 53262), the angles sometimes rounded (Ref. 2, 54167). Central caudal fin skeleton with 3 epurals, 5 hypurals and 2 pairs of uroneurals (Ref. 57928). No genital tassel (Ref. 55077). Coloration: basic melanin pattern of 2 horizontal and 6-7 vertical bars never fully realized; more commonly, at least in preserved specimens, females and sexually inactive males have no bands, but may have the intersection points of the facultative bands represented by 3-4 upper and 2-5 mid-lateral blotches, or some or all of these may be present (Ref. 2). Basic body coloration silvery grey (Ref. 2, 52307) to greenish grey, sometimes a more bluish colored head (Ref. 52307). Belly greyish (Ref. 4904, 5214, 54167). Spiny part of dorsal fin light with dark mottling (Ref. 3058). Soft dorsal and anal, and caudal and pelvic fins blackish (Ref. 2989, 3058, 3060, 54167). Pectoral fins colorless (Ref. 3058, 3060). Indistinct, dark opercular spot present (Ref. 1870, 2989, 3058, 3060, 53262, 54167, 54759). Vertical fins uniform (Ref. 54167), blackish with more or less distinct whitish spots(Ref. 552) or with large or small, fused or non-fused, dark spots on a pale background (Ref. 6460, 54167), given a darker aspect to these fins (Ref. 6460). 3 black blotches present in juveniles but possibly obscured in adults due to the dark body coloration of breeding males or old adults (Ref. 12524, 13337). Female and non-breeding male: dirty yellowish-olive (Ref. 12522) or silvery-gray, with 2-5 mid-lateral blotches and some of a more dorsal series (Ref. 2, 52307). Sometimes a series of more or less distinct spots along the side of the body above and below the upper lateral line (Ref. 54167). Breeding male: uniform dark olive-brown (Ref. 4904, 54167), deep blue-black (Ref. 2) or black, with white lower parts of head (Ref. 2, 4904, 7248, 54167), including throat, lower lips, lower parts of cheeks and opercles, but with a dark blue to black base to the throat (Ref. 12501, 52307), and red margins to dorsal and caudal fins (Ref. 2, 7248, 12522, 12501, 12524, 13337, 52307). Dorsal fin with light coloured spots on membrane between spinous and soft rays (Ref. 12524, 13337). Caudal fin olive-green with light coloured spots on anterior section (Ref. 12524, 13337), but may sometimes appear totally red (Ref. 52307). Tip of dorsal and extremity of caudal lobes yellowish (Ref. 4904, 54167). Anal fin dark gray (Ref. 52307) or olive-green (Ref. 12524, 13337), sometimes with a thin red/orange margin (Ref. 12501, 12522, 12524, 13337, 52307). Unpaired fins normally exhibit greenish to silvery iridescent dots (Ref. 52307). Pectoral fin rays red (Ref. 2). Pectoral and pelvic fins olive-yellow (Ref. 12524). Juveniles: body silvery (Ref. 2, 5214, 6465, 7248, 12524, 13337, 55020, 57960) or olive-brown, light on belly (Ref. 54167). Scales with dark outer edge (Ref. 54167). Usually 5-8 or more indistinct dark cross bars on body (Ref. 2, 6460, 7248, 39866, 54167, 55020), often in addition to the 2 series of blackish spots (Ref. 54167), but with no horizontal stripes (Ref. 2). Dark opercular spot (Ref. 6460, 54167), on posterior dorsal edge of operculum (Ref. 55020). Black spot at base of anterior rays of soft dorsal (Ref. 552, 54167) and 1-2 whitish spots enclosed by dark streaks (Ref. 54167). Oblique streaks (Ref. 6460) or translucent round spots (Ref. 55020) on soft dorsal. Anal dark at base with a light outer half (Ref. 54167), with oblique streaks (Ref. 6460). Caudal dark at base, light in centre, a black outer ridge (Ref. 54167), with 2-3 bars across the fin (Ref. 6460). Tilapia-spot present (Ref. 2, 5214, 6465, 12501), conspicuous in younger fish persisting albeit faintly to 8cm (Ref. 55020). Fins flesh coloured (Ref. 12524, 13337), all except soft dorsal immaculate (Ref. 55020).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs at temperatures ranging from 8°-42°C (Ref. 3). Lives in warm, weedy pools of sluggish streams, canals, and ponds (Ref. 5723). Is mainly diurnal. May form schools. Omnivorous, feeds on almost anything from algae to insects. Can be reared under hypersaline conditions (Ref. 4537). Marketed fresh and frozen (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

The blue tilapia, Oreochromis aureus, and the blackchin tilapia Sarotherodon melanotheron also occur as exotic species in Florida. They sre superficially quite similar to Oreochromis mossambicus, but species-specific markings (e.g., the black chin of S. melanotheron which O. aureus lacks) as well as differing spine/ray counts are sufficient to differentiate the species from one another.
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Zambezi River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Zambezi River system of southern Africa. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

Nutrient levels in the Zambezi River are relatively low, especially in the upper Zambezi; in that reach, above Victoria Falls, most of the catchment drains Kalahari sands, whose nutrient levels are inherently low due to their aeolian formation; moreover, agricultural fertilizer addition throughout the Zambezi watershed is low, due to the shortage of capital available to farmers of this region.

Nitrate levels (as nitrogen) in the upper Zambezi are typically in the range of .01 to .03 milligrams per liter. Correspondingly electrical conductivity of the upper Zambezi is on the order of 75 micro-S per centimeter, due to the paucity of ion content. From the Luangwa River downstream nitrate levels elevate to .10 to .18 milligrams per liter, and electrical conductivity rises to a range of two to four times the upper Zambezi levels. Not surprisingly, pH, calcium ion concentration, bicarbonate and electrical conductivity are all higher in portions of the catchment where limestone soils predominate compared to granite.

There are a total of 190 known fish species present in the Zambezi River, including eel and shark taxa. The largest native benthopelagic fish in the Zambezi are the 170 cm North African catfish (Clarias gariepinus), the 146 cm common carp (Cyprinus carpio carpio), the 150 cm Indo-Pacific tarpon (Megalops cyprinoides) and the introduced 120 cm rainbow trout (Oncorhynchus mykiss).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

benthopelagic; amphidromous (Ref. 51243); freshwater; brackish; depth range 1 - 12 m (Ref. 57895)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Occurs in all but fast-flowing waters; thrives in standing waters. Further south in its range it is most common in blind estuaries and coastal lakes where it tolerates brackish and marine environments. Feeds on algae, especially diatoms, and detritus, large individuals also take insects and other invertebrates. Breeds in summer, females raising multiple broods every 3 to 4 weeks during a season. Males construct a saucer-shaped nest on sandy bottoms: the female mouthbroods the eggs, larvae and small fry. Juveniles shoal in shallow water. Prone to stunting under adverse or crowded conditions (Skelton 2001).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.2 - 2
  Temperature range (°C): 27.537 - 27.537
  Nitrate (umol/L): 0.447 - 0.447
  Salinity (PPS): 34.880 - 34.880
  Oxygen (ml/l): 4.613 - 4.613
  Phosphate (umol/l): 0.121 - 0.121
  Silicate (umol/l): 2.033 - 2.033

Graphical representation

Depth range (m): 0.2 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Generally in warm weedy ponds, canals, and river pools and backwaters. Able to live and reproduce in fresh water and sea water. Lower temperature tolerance about 11-12 C. Established in thermal springs and outflow in Idaho (Courtenay et al. 1987). Spawns over shallow pit in male's territory in shallow weedy waters; female goes into hiding while incubating eggs in her mouth (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits lower Zambezi, Limpopo and eastern rivers southwards. Prefers sheltered banks provided with vegetation. The adult tilapia mainly occupy deeper terraces which surround the lake at high-water levels. Feeds on detritus, plankton, and algae (Ref. 11889). Small fish fed initially on zoobenthos and zooplankton, but fish with a mass of over 4 g fed increasingly on Microcystis aeruginosa and detritus (Ref. 43783). Increased in rainfall improved the quality of diet, as level of protein, energy and organic matter in the diet increased in quantity (Ref. 52847).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonselective omnivore; eats planktonic algae, aquatic plants, invertebrates, and small fishes (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oreochromis mossambicus are generalist/opportunistic omnivores that consume detrital material, vegetation ranging from diatoms to macroalgae to rooted plants, invertebrates, and small fish (Bowen 1979, Mook 1983, Trewevas 1983). Diets differ depending on location-specific resource availability. De Silva et al. (1984) report O. mossambicus populations in different lakes ate different diets and trophic strategies ranged from detritivory, to herbivory, to near-exclusive carnivory with individuals preying on small fish and invertebrates.
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Oreochromis mossambicus co-occurs with a number of other non-native tilapia species in Florida. Possible hybridization between Mozambique tilapia and blue tilapia (O. aureus) has been reported in Florida, e.g., in Dade County drainage canals (Shafland 1996).Invasion History: Oreochromis mossambicus have been both intentionally and accidentally released to many non-native areas worldwide in a variety of ways and for a number of reasons. Intentional release has often been for purposes of plant or pest (e.g., mosquito) control, although Moyle (1976) notes that population densities often failed to grow large enough to effectively control insect or plant populations. Intentional release has also occurred in attempts to establish populations to be utilized as sportfish, bait fish, or commercial stocks, while accidental release has occurred at a number of hatcheries, fish farms, aquariums and zoos (Shapovalov et al. 1981, Dial and Wainright 1983, Grabowski et al. 1984, Courtenay and Stauffer 1990).In Florida, O. mossambicus was first introduced into Dade County during the 1960s where it first became established (Hogg 1976, Courtenay and Stauffer 1990). The species was introduced into the Indian River Lagoon basin either as releases or escapes from fish farms or aquarium owners (Courtenay et al. 1974, Dial and Wainright 1983). Courtney et al. (1984) reported the probable release of the fish in the IRL watershed by a developer to control plant growth.O. mossambicus individuals have been collected in Everglades National Park and have been reported as present within the greater Everglades drainage (Tilmant 1999, Nico 2006).Nico (2006) reports that O. mossambicus is established or locally established in seven states (Arizona, California, Colorado, Florida, Hawaii, Idaho, and Texas) and formerly locally established but no longer extant in Georgia, Montana, and North Carolina. The author also and reports O. mossambicus from Alabama, Illinois, and New York, but they appear to not be established there.Costa-Pierce (2003) suggests that the mouth-brooding maternal habit of the species is important as a mechanism of dispersal and establishment for founder populations of O. mossambicus. Potential to Compete With Natives: Oreochromis mossambicus pose threats to local native populations through competition for food and nesting space (Courtenay et al. 1974). This interaction may reduce the biodiversity of the native fishery due to reduction of food availability and/or by the native fish being eaten as prey (Neil 1966, Bruton and Boltt 1975). In Hawaii, striped mullet (Mugil cephalus) are threatened because of the introduction of this species. Mozambique tilapia may also be responsible for the decline of the desert pupfish, Cyprinodon macularius, in California's Salton Sea (Courtenay and Robins 1989, Swift et al. 1993).Courtenay (1989) predicts that the Mozambique tilapia could eventually become established within the Florida Everglades, with potentially devastating effects.Oreochromis mossambicus has been nominated by the Invasive Species Specialist Group (ISSG) as among "100 of the World's Worst" invasive alien species. Possible Economic Consequences of Invasion: Mozambique tilapia are hardy individuals that are easy to grow, which makes them an ideal aquaculture species. Tilapia have a mild, white flesh that appeals to consumers, making them economically important food fish. This species contributes about 4% of the total tilapia aquaculture production worldwide, and is valued more when used for hybridization (Gupta and Acosta 2004). However, because of this hardiness, they can out-compete native species when released into the natural environment. This may displaces or eliminate native species.
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Oreochromis mossambicus (Tilapia mossambica) preys on:
detritus
Bacillariophyceae

Based on studies in:
USA: Hawaii (Swamp)

This list may not be complete but is based on published studies.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (AAAS Publication 83, Washington, DC, 1967), pp. 420-431, from p. 429.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Velvet Disease 2 (Piscinoodinium sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Turbidity of the Skin (Freshwater fish). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trichodinella Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trichodina Infection 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trichodina Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Transversotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spinning Tilapia Syndrome. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Saccocoelioides Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhabdochona Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pentastoma Infection 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Orientocreadium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lernaea Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Lopez, N.C. 2001 Parasitic crustaceans in fishes from some Philippine lakes. p.75-79. In C.B. Santiago, M.L. Cuvin-Aralar and Z.U. Basiao (eds) Conservation and ecological management of Philippine lakes in relation to fisheries and aquaculture. SEAFDEC, Aquacult. Dept., Iloilo,Phil., PCAMRD, Los Baños, Lag., & BFAR Q.C. Phil.,187p. (Ref. 45120)   http://www.fishbase.org/references/FBRefSummary.php?id=45120&speccode=2 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyophthirius Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

HTRLO Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goezia Disease 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gnathostoma Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gnathostoma Disease (larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish Tuberculosis 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish Louse Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

False Fungal Infection (Epistylis sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euclinostomum Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dolops Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diplostomum Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cryptobia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Contracaecum Disease (larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cichlidogyrus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cichlidogyrus Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Amyloodinium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ambiphyra Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Specific abundance information relative to Oreochromis mossambicus in Florida is sparse, other than statements by authorities that the species is established in several counties and reported as occurring with unknown reproductive status in others.Dial and Wainright (1983) suggest that actual abundance of this species in Florida has been obscured by confusion of Mozambique tilapia and blackchin tilapia, Sarotherodon melanotheron, by commercial fishermen.
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns at the edge of the littoral terrace of lakes (Ref. 1, 2, 87, 6465), in sandy or muddy bottoms (Ref. 57425). Displays a lek mating system; territorial males establish breeding territories where they dig spawning pits, assume a dark coloration, defend a breeding territory and actively court females; sneaking males intrude into nests during a spawning episode, exhibiting quivering behavior which is usually an indicator of sperm release; sneaking is predominantly performed by subordinate males, which may adopt pseudo-female behavior (Ref. 57425). Only territorial males produce sounds, during all phases of courtship but especially during the late stages, including spawning (Ref. 49830). Territorial male excavates and defends a basin-shaped pit in the center of his territory, where female deposits 100-1700(1800) eggs (Ref. 44894, 52307). Eggs and milt are sucked up by the female (Ref. 2, 44894). Fertilization is reported to sometimes occur in the mouth of the female (Ref. 6028). Females incubate eggs alone (Ref. 12501, 52307). It is possible, albeit rare, that males take up some eggs after spawning (Ref. 2, 5726, 52307, 57895), but they almost always eat them soon after (Ref. 52307). Females school together while mouthbrooding (Ref. 40035), they cease to feed and subsist on food reserves stored in their body (Ref. 1). Females may spawn a full clutch with just one male, or may spawn with several different males in a series (Ref. 52307). Water is circulated over the eggs by chewing movements of the jaws (Ref. 12501, 12522). Fry hatch in the female's mouth after 3-5 days (Ref. 2, 12501, 12522, 44894, 52307), depending on the temperature (Ref. 52307). The young are released from the mouth in 10-14 days, but remain near the female and enter the mouth if threatened until about 3 weeks old (Ref. 2, 44894, 52307). Fry and juveniles shoal in shallow water (Ref. 6465, 7248, 57895) where they feed during the day, and retreat to deep water at night (Ref. 87, 6465). Females raise multiple broods during a season (Ref. 7248, 57895).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawns as long as water temperature is above 20 C; maternal mouthbrooder; eggs hatch and leave female's mouth in 11-12 days (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Female Oreochromis mossambicus mature at approximately 150-160 mm, and males mature at approximately 170-180 mm (Hodgkiss and Man 1978, Arthington and Milton 1986). Males construct nests in sparse to moderately vegetated bottoms where fertilization of the eggs takes place (Bruton and Bolt 1975). Several different females will lay eggs in the nest. Females can lay between 50-1,780 eggs, based on individuals' size and environmental conditions. (Trewevas 1983). Males are generally aggressive and ritualistic during reproductive season, although male-male confrontations rarely actually become violent (Bruton and Bolt 1975).
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Once fertilized, the female Oreochromis mossambicus takes the eggs into her buccal cavity (mouth) and broods them until hatching. Hatching occurs in approximately 3-5 days. Once hatched, the females continue to mouth-brood the fry until they are approximately 14-21 days old. Male O. mossambicus are reported to occasionally mouth-brood eggs and fry as well (Bruton and Bolt 1975, Arthington and Milton 1986).
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372-379.
  • Shafland P.L. and J.M. Pestrak. 1982. Lower lethal temperatures for fourteen non-native fishes in Florida. Environmental Biology of Fishes 7:139-156.
  • Shafland P.L. 1996. Exotic Fishes of Florida-1994. Reviews in Fisheries Science 4:101-122.
  • Arthington A.H., and D.A. Milton. 1986. Reproductive biology, growth and age composition of the introduced Oreochromis mossambicus (Cichlidae) in two reservoirs, Brisbane, Australia. Environmental Biology of Fishes 16:257-266.
  • Bowen S.H. 1979. A nutritional constraint in detritivory by fishes: The stunted population of Sarotherodon mossambicus in Lake Sibaya, South Africa. Ecological Monographs 49:17-31.
  • Brown W. H. 1961. First Record Of The African Mouthbreeder Tilapia Mossambica Peters In Texas. Texas Journal of Science 13:352-354.
  • Bruton M.N., and B.R. Allanson. 1974. The growth of Tilapia mossambica Peters (Pisces: Cichlidae) in Lake Sibaya, South Africa. Journal of Fish Biology 6:701-715.
  • Bruton M.N., and R.E. Boltt. 1975. Aspects of the biology of Tilapia mossambica Peters (Pisces: Cichlidae) in a natural freshwater lake (Lake Sibaya, South Africa). Journal of Fish Biology 7:423-445.
  • Boschung, H.T., and R.L Mayden. 2004. Mozambique Tilapia: Oreochromis mossambicus (Peters). Pp 620. In: Fishes of Alabama. Smithsonian Books. Washington D.C. 960 p.
  • Costa-Pierce B. 2003. Rapid evolution of an established feral tilapia (Oreochromisspp.): The need to incorporate invasion science into regulatory structures. Biological Invasions 5:71-84.
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237-252 in: Thomas L.K. (Ed) . Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, DC.Courtenay W.R., Jr., and J.R. Stauffer, Jr. 1990. The introduced fish problem and the aquarium fish industry. Journal of the World Aquaculture Society 21:145-159.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159-172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292-302.
  • De Silva S.S., Perera M.K., and P. Maitipe. 1984. The composition, nutritional status and digestibility of the diets of Sarotherodon mossambicus from nine man-made lakes in Sri Lanka. Environmental Biology of Fishes 11:205-219.
  • Dial R.S. and S.C. Wainright. 1983. New distributional records for non-native fishes in Florida. Florida Scientist 46:8-15.
  • Fryer G., and T.D. Illes. 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publishing, Hong Kong. 610 p.
  • Grabowski S.J., S.D. Hiebert, and D.M. Lieberman. 1984. Potential for introduction of three species of nonnative fishes into central Arizona via the Central Arizona Project: A literature review and analysis. REC-ERC-84-7. U.S. Department of the Interior, Bureau of Reclamation, Denver, CO.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia. Available online.
  • Hodgkiss I.J., and H.S.H. Man. 1978. Reproductive biology of Sarotherodon mossambicus (Cichlidae) In Plover Cove Reservoir, Hong Kong. Environmental Biology of Fish 3:287-292.
  • Hogg R.G. 1976. Established exotic cichlid fishes in Dade County, Florida. Florida Scientist 39:97-103.
  • Hubbs C., Lucier T., Garrett G.P., Edwards R.J., Dean S.M., Marsh E., and D. Belk. 1978. Survival and abundance of introduced fishes near San Antonio, Texas. Texas Journal of Science 30:369-376.
  • Knaggs E.H. 1977. Status of the genus Tilapia in California's estuarine and marine waters. California-Nevada wildlife Transactions 1977:60-67.
  • Lee D.S., Gilbert C.R., Hocutt C.H., Jenkins R.E., McAllister D.E., and J.R. Stauffer, Jr. 1980. Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History, Raleigh, NC. 854 p.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.Neil E.H. 1966. Observations on the behavior of Tilapia mossambica (Pisces, Cichlidae) in Hawaiian ponds. Copeia 1966:50-56.
  • Nico, L. 2006. Oreochromis mossambicus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. Available online.
  • Riedel R., and B.A. Costa-Pierce. 2005. Feeding ecology of Salton Sea Tilapia (Oreochromis spp.). Bulletin of the Southern California Academy of Sciences 104:26-36.
  • Shapovalov L., Cordone A. J., and W.A. Dill. 1981. A list of freshwater and anadromous fishes of California. California Fish and Game 67:4-38.
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101-167.
  • Tilmant, J.T. 1999. Management of nonindigenous aquatic fish in the U.S. National Park System. National Park Service. 50 p.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Whiteside B.G. 1975. Additional distribution notes on the Mozambique tilapia in Texas. Texas Journal of Science 26:620.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreochromis mossambicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGATTCTTCTCAACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACTGCACTAAGTCTCCTTATTCGGGCAGAACTAAGCCAGCCCGGCTCTCTCCTCGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAACTGACTGGTGCCACTTATGATTGGGGCACCAGACATGGCCTTCCCTCGAATAAATAACATGAGTTTTTGACTCCTTCCCCCCTCATTTCTCCTTCTCCTCGCCTCCTCCGGAGTCGAAGCAGGAGCCGGTACAGGATGAACTGTTTATCCTCCCCTCGCAGGCAATCTCGCCCACGCTGGGCCTTCTGTTGACTTAACCATCTTCTCCCTCCACTTAGCCGGGGTGTCATCTATTTTAGGTGCAATTAATTTTATCACAACCATCATTAACATAAAACCCCCTGCCATCTCTCAATATCAAACACCCCTCTTTGTGTGATCCGTTCTAATTACCGCAGTATTACTCCTACTATCCCTGCCCGTTCTTGCCGCCGGTATCACAATACTTCTAACAGACCGAAACCTAAACACAACCTTCTTTGACCCTGCCGGAGGAGGAGACCCCATCCTTTACCAACACTTATTCTGATTCTTTGGGCACCCTGAAGTTTACATTCTTATCCTCCCCGGCTTTGGAATAATTTCCCACATTGTTGCCTACTATGCAGGCAAAAAAGAACCTTTCGGATACATGGGAATGGTCTGAGCCATGATGGCTATCGGCCTCCTAGGGTTTATTGTTTGAGCCCATCACATATTCACCGTAGGAATGGACGTAGACACACGAGCTTACTTTACTTCCGCCACAATAATTATTGCCATCCCAACTGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTGCACGGCGGTGCCATTAAATGAGAAACCCCTCTCCTGTGGGCGCTAGGCTTCATTTTCCTCTTTACAGTTGGAGGATTGACCGGAATCGTTCTAGCTAATTCTTCTCTAGACATTATGCTTCACGACACATATTATGTCGTCGCCCACTTCCACTATGTCCTCTCAATAGGAGCCGTTTTCGCCATTGTTGCCGGCTTCGTCCACTGATTCCCCCTATTCTCAGGGTACACGCTTCACGACACTTGAACAAAAATCCACTTTGGGGTTATATTTGTAGGGGTTAACCTTACTTTCTTCCCACAACACTTCCTAGGACTGGCAGGAATGCCTCGACGATACTTCCGACTACCCCGACGCCTACACCCTTTGAAACACAATCTCTTCTATTGGCTCAATAATTTCAATAGTCAGCGAGGAATTATGTGTTTTATTTATTATATTGAGAAGCATTTGCCGCTAAACGAGAAAGTCCTATCAGTGGAACTTACAGCAACAAACGTAGAATGACTTCACGGTTGCCCTCCCCCTTACCACACCTTTGAAGAGCCTGCCTTCGTCCAAGTTCAACAAGCCTGATTAGACTACGGAAAATCTGCTACCACCCCCTCAAAATCCCACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oreochromis mossambicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 68
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Cambray, J. & Swartz, E.

Reviewer/s
Tweddle, D. (Freshwater Fish Red List Authority) & Darwall, W. (Freshwater Biodiversity Assessment Unit)

Justification
Threatened by hybridization with the rapidly spreading Oreochromis niloticus. Oreochromis niloticus is being spread by anglers and for aquaculture. Hybridization is already occurring throughout the northern part of the species' range, with most of the evidence coming from the Limpopo River system. In terms of locations the threat of Oreochromis niloticus is widespread, but probably more than 50% of the locations are not yet affected. Given the rapid spread of O. niloticus it is anticipated that this species will qualify as threatened under Criterion A due to rapid population decline through hybridization. The species is therefore assessed as Near Threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Common and widespread through south eastern Africa.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The Nile tilapia, Oreochromis niloticus, is invading its natural range in the Zambezi and Limpopo systems. Hybridisation is occurring in the Limpopo system and pure O. mossambicus are likely to become extirpated in those systems through competition and hybridisation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
River systems not yet invaded by Nile tilapia must be protected from deliberate and accidental introductions of that species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Oreochromis mossambicus

The Mozambique tilapia, Oreochromis mossambicus, is a tilapiine cichlid fish native to southern Africa. It is a popular fish for aquaculture. It is now found in tropical and subtropical habitats around the globe, where it can become an invasive species. It is known as Blue Kurper in South Africa.[2]

Contents

Description [edit]

The native Mozambique tilapia is laterally compressed, and has a deep body with long dorsal fins, the front part of which have spines. Native coloration is a dull greenish or yellowish, and there may be weak banding. Adults reach approximately 35 centimetres (14 in) in length and up to 1.13 kilograms (2.5 lb). Size and coloration may vary in captive and naturalized populations due to environmental and breeding pressures. It lives for up to 11 years.

It is a remarkably robust and fecund fish, readily adapting to available food sources and breeding under suboptimal conditions. It also tolerates brackish water and survives temperatures below 50 °F (10 °C) and above 100 °F (38 °C).

Home range [edit]

The Mozambique tilapia is native to coastal regions and the lower reaches of rivers in southern Africa, from the Zambezi River delta to Bushman River in the eastern Cape.[3] It is threatened in its home range by competition with the invasive Nile tilapia.[4]

Diet [edit]

Mozambique tilapia are omnivorous. They can consume detrital material, diatoms, invertebrates, small fry and vegetation ranging from macroalgae to rooted plants.[5][6] This broad diet helps the species thrive in diverse locations.

Invasiveness [edit]

The Mozambique tilapia is an invasive species in many parts of the world, having escaped from aquaculture or been deliberately introduced to control mosquitoes.[7] It has been nominated by the Invasive Species Specialist Group (ISSG) as one the 100 worst invasive species in the world.[8] It can harm native fish populations through competition for food and nesting space, as well as by directly consuming small fish.[9] In Hawaii, striped mullet Mugil cephalus are threatened because of the introduction of this species. Mozambique tilapia may also be responsible for the decline of the desert pupfish, Cyprinodon macularius, in California's Salton Sea.[10][11]

Hybridization [edit]

As with most species of tilapia, Mozambique tilapia have a high potential for hybridization. They are often crossbred with other tilapia species in aquaculture because purebred Mozambique tilapia grow slowly and have a body shape poorly suited to cutting large fillets. Also, hybrids between certain parent combinations (such as between Mozambique and Wami tilapia) result in offspring that are all or predominantly male. Male tilapia are preferred in aquaculture as they grow faster and have a more uniform adult size than females. The "Florida Red" tilapia is popular commercial hybrid of Mozambique and Blue tilapia.[12]

Reproduction [edit]

In the first step in the reproductive cycle for Mozambique tilapia, males excavate a nest into which a female can lay her eggs. After the eggs are laid the male fertilizes them. Then the female stores the eggs in her mouth, called mouthbrooding, until the fry hatch.[13]

Use in aquaculture [edit]

A Mozambique Tilapia caught in a man-made lake where it naturally occurs along with species introduced for aquaculture in Pune, India.

Mozambique tilapia are hardy individuals that are easy to raise and harvest, making them a good aquacultural species. They have a mild, white flesh that is appealing to consumers. This species constitutes about 4% of the total tilapia aquaculture production worldwide, but is more commonly hybridized with other tilapia species.[14] Tilapia are very susceptible to diseases such as whirling disease and ich.[15]

Other names [edit]

The species is known by a number of other names including:

Notes [edit]

  1. ^ Cambray, J. & Swartz, E. 2007. Oreochromis mossambicus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. <www.iucnredlist.org>. Downloaded on 10 May 2013.
  2. ^ Big Bass
  3. ^ http://www.issg.org/database/species/ecology.asp?si=131
  4. ^ Waal 2002
  5. ^ Mook 1983
  6. ^ Trewevas 1983
  7. ^ Moyle 1976
  8. ^ Courtenay 1989
  9. ^ Courtenay et al. 1974
  10. ^ Courtenay and Robins 1989
  11. ^ Swift et al. 1993
  12. ^ http://edis.ifas.ufl.edu/FA012
  13. ^ Popma, 1999
  14. ^ Gupta and Acosta 2004
  15. ^ Popma, 1999

References [edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2007). "Oreochromis mossambicus" in FishBase. 2 2007 version.
  • "Oreochromis mossambicus". Integrated Taxonomic Information System. Retrieved 10 January 2007. 
  • Courtenay W.R., Jr. 1989. Exotic fishes in the National Park System. Pages 237–252 in: Thomas L.K. (ed.). Proceedings of the 1986 conference on science in the national parks, volume 5. Management of exotic species in natural communities. U.S. National Park Service and George Wright Society, Washington, D.C.
  • Courtenay W.R., Jr., and C.R. Robins. 1989. Fish introductions: Good management, mismanagement, or no management? CRC Critical Reviews in Aquatic Sciences 1:159–172.
  • Courtenay W.R., Jr., Sahlman H.F, Miley W.W., II, and D.J. Herrema. 1974. Exotic fishes in fresh and brackish waters of Florida. Biological Conservation 6:292–302.
  • Gupta M.V. and B.O. Acosta. 2004. A review of global tilapia farming practices. WorldFish Center P.O. Box 500 GPO, 10670, Penang, Malaysia.
  • Mook D. 1983. Responses of common fouling organisms in the Indian River, Florida, to various predation and disturbance intensities. Estuaries 6:372–379.
  • Moyle P.B. 1976. Inland fishes of California. University of California Press, Berkeley, CA. 330 p.
  • Popma, T. Tilapia Life History and Biology 1999 Southern Region Aquaculture Center
  • Swift C.C., Haglund T.R., Ruiz M., and R.N. Fisher. 1993. The status and distribution of the freshwater fishes of southern California. Bulletin of the Southern California Academy of Science 92:101–167.
  • Trewevas E. 1983. Tilapiine Fishes Of The Genera Sarotherodon, Oreochromis And Danakilia. British Museum Of Natural History, Publication Number 878.Comstock Publishing Associates. Ithaca, New York. 583 p.
  • Waal, Ben van der, 2002. Another fish on its way to extinction?. Science in Africa.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as TILAPIA MOSSAMBICA (see Fuller et al. 1999). Placed in genus Sarotherodon by some authors.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!