Overview

Comprehensive Description

Biology

Occurs inshore (Ref. 7300); surf zones off sandy beaches (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southwest Pacific: eastern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachinotus coppingeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGTATAGTAGGGACAGCTTTAAGCCTACTTATCCGAGCAGAGCTTAGCCAACCCGGCGCCCTCTTAGGAGATGACCAAATTTACAACGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATCGGAGGCTTTGGAAACTGACTTATCCCCCTAATGATTGGGGCCCCTGATATAGCATTTCCTCGAATGAACAATATGAGCTTCTGACTTCTGCCCCCTTCTTTCCTTCTTCTTCTCGCTTCCTCAGGAGTAGAAGCAGGTGCTGGAACTGGTTGAACAGTTTACCCTCCCCTGGCTGGAAACCTTGCTCATGCGGGAGCATCTGTTGATCTAACTATTTTCTCCCTTCACTTAGCCGGAATTTCCTCAATTCTTGGAGCAATCAACTTTATTACAACAGTAATTAACATAAAACCCCATGCTGTTTCCATGTACCAAATTCCACTATTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTCTCACTCCCCGTTCTAGCTGCAGGCATTACAATGCTTCTTACGGATCGAAACTTAAACACCGCCTTCTTTGACCCGGCCGGGGGAGGGGATCCAATCCTCTACCAACACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trachinotus coppingeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!