Overview

Comprehensive Description

Biology

Adults occur inshore (Ref. 7300), in surf zones off sandy beaches (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southwest Pacific: eastern Australia.
  • Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley 1989 Pisces. Petromyzontidae to Carangidae. Zoological Catalogue of Australia, Vol. 7. Australian Government Publishing Service, Canberra, 665 p. (Ref. 7300)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachinotus coppingeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGTATAGTAGGGACAGCTTTAAGCCTACTTATCCGAGCAGAGCTTAGCCAACCCGGCGCCCTCTTAGGAGATGACCAAATTTACAACGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATCGGAGGCTTTGGAAACTGACTTATCCCCCTAATGATTGGGGCCCCTGATATAGCATTTCCTCGAATGAACAATATGAGCTTCTGACTTCTGCCCCCTTCTTTCCTTCTTCTTCTCGCTTCCTCAGGAGTAGAAGCAGGTGCTGGAACTGGTTGAACAGTTTACCCTCCCCTGGCTGGAAACCTTGCTCATGCGGGAGCATCTGTTGATCTAACTATTTTCTCCCTTCACTTAGCCGGAATTTCCTCAATTCTTGGAGCAATCAACTTTATTACAACAGTAATTAACATAAAACCCCATGCTGTTTCCATGTACCAAATTCCACTATTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTCTCACTCCCCGTTCTAGCTGCAGGCATTACAATGCTTCTTACGGATCGAAACTTAAACACCGCCTTCTTTGACCCGGCCGGGGGAGGGGATCCAATCCTCTACCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trachinotus coppingeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!