Overview

Comprehensive Description

Biology

Adults form schools in clear coastal areas, usually near coral formations (Ref. 5217). Juveniles common in clean sandy beaches (Ref. 5217). Feeds on crustaceans, polychaete worms, insect pupae, mollusks and fishes (Ref. 9626). Between 1995 and 2000, at least 2 specimens were traded as aquarium fish at Fortaleza, Ceará (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and the Gulf of Mexico to Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Trachinotus goodei is distributed in coastal waters around the western Atlantic from Massachusetts, east to Bermuda, and south to Argentina, including the Northern and Southern Gulf of Mexico, (McEachran and Fechhelm 2005) and the Caribbean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and the Gulf of Mexico to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 19 - 20; Anal spines: 2 - 3; Analsoft rays: 16 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 560 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal and anal fins have very long, dark anterior lobes (Ref. 26938). Bluish silver on back, shading to silver on sides, with four narrow dark bars on upper of body (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 12 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Trachinotus goodei is a coastal species found in sub-tropical climates at a depth range of 0–12 m. Adults of this species are usually found in clear coastal areas and in the surf zone along sandy beaches where they form large schools. They are also found around reefs and rocky areas (FAO 2002). Juveniles are common near clean, sandy beaches. This species is usually associated with high water salinity (FAO 2002). Trachinotus goodei feeds on crustaceans, polychaete worms, insect pupae, molluscs, and fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0 - 15
  Temperature range (°C): 26.770 - 27.724
  Nitrate (umol/L): 0.174 - 0.997
  Salinity (PPS): 34.217 - 36.993
  Oxygen (ml/l): 4.538 - 4.667
  Phosphate (umol/l): 0.051 - 0.169
  Silicate (umol/l): 1.862 - 2.813

Graphical representation

Depth range (m): 0 - 15

Temperature range (°C): 26.770 - 27.724

Nitrate (umol/L): 0.174 - 0.997

Salinity (PPS): 34.217 - 36.993

Oxygen (ml/l): 4.538 - 4.667

Phosphate (umol/l): 0.051 - 0.169

Silicate (umol/l): 1.862 - 2.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 12m.
Recorded at 12 meters.

Habitat: reef-associated. Adults and juveniles commonly forming large schools in the the surf zone and clear water along sandy beaches, around reefs and rocky areas. Occurs in large schools (Ref. 5521). Feeds on crustaceans, polychaete worms, insect pupae, molluscs and fishes (Ref. 9626).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Adults form schools in clear coastal areas, usually near coral formations (Ref. 5217). Juveniles common in clean sandy beaches (Ref. 5217). Feeds on crustaceans, polychaete worms, insect pupae, mollusks and fishes (Ref. 9626).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachinotus goodei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGRATAGTAGGTACAGCTTTAAGCCTACTTATTCGAGCGGAGCTTAGTCAACCCGGCGCCCTCCTAGGAGATGACCAAATTTACAATGTAATCGTTACAGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTTATTCCACTAATGATTGGAGCTCCAGATATGGCATTCCCTCGAATGAATAACATGAGCTTCTGACTCCTCCCTCCCTCTTTTCTTCTCCTTCTTGCCTCCTCAGGAGTAGAAGCAGGTGCCGGAACCGGTTGAACAGTCTATCCCCCCTTAGCTGGTAATCTTGCCCATGCAGGAGCATCCGTTGATTTAACCATTTTCTCCCTTCACCTAGCTGGWWTTTCATCAATTCTAGGGGCTATCAACTTCATTACGACAGTAATCAACATAAAACCCCATGCTGTCTCTATATACCAGATCCCACTATTTGTCTGAGCCGTTCTAATTACAGCCGTCCTCCTGCTTCTCTCACTACCTGTTTTAGCCGCTGGCATTACAATACTTCTTACTGATCGAAACCTAAACACTGCCTTCTTTGACCCAGCCGGAGGAGGAGATCCCATCCTATACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trachinotus goodei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M. (Sampled Red List Index Coordinating Team)

Reviewer/s
Carpenter, K.E., Livingstone, S. & Polidoro, B.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Trachinotus goodei has been listed as Least Concern. Although harvested for human consumption, this is not thought to be a major threat to the global population of this broadly distributed species. This species is also known to be farmed, which is likely to have reduced the impact of harvesting of this species from the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for Trachinotus goodei.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Trachinotus goodei is fished commercially, and is caught using seines and by sport fishers with hook-and-line. This species is not fished selectively and is found in Central and South American markets (FAO 2002). This species is also farmed for aquaculture, therefore commercial harvesting is unlikely to be a major threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Trachinotus goodei is farmed for aquaculture and may be bred in captivity for this purpose. The distribution of this species may fall within numerous marine protected areas. Monitoring of the harvest levels of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Trachinotus goodei

The Palometa,Trachinotus goodei, is an ocean-going game fish of the family Carangidae. In the wild, Palometa eat worms, insect pupae, and smaller fish.[2]

Contents

Description

Palometa are most recognized by their elongated dorsal and anal fins with dark anterior lobes.[3] The dorsal fin usually has 7-8 spines and 19-20 soft rays, while the anal fin has 2-3 spines and 16-18 soft rays.[4] They can have colors from gray to blue-green on the tops of their heads, and have silver-colored sides with four narrow, vertical bars. A Palometa's breast usually has an orange tinge, and the tips of their fins are darkened. The tail has no scutes, unlike many members of its family, and has a faint fifth vertical bar near the base.[5] The largest known Palometa was 50cm long;[6] The largest known weight of any Palometa is 560g.[7]

Distribution and habitat

Palometa prefer clear, tropical water of sandy shores and bays. They are also known to swim in small shoals above coral reefs.[5] Palometa are found only in the western Atlantic ocean from Massachusetts, east to Bermuda, south to Argentina. They are also found in the Gulf of Mexico and the Caribbean sea.[4]

Reproduction

Little is known about the reproduction of the Palometa. They are thought to spawn far offshore during all seasons, save winter.[8] Young Palometa have shown high growth rates in maricultural experiments.[9]

Importance to humans

Though there have been reports of ciguatera poisoning,[10] the Palometa is considered primarily a game fish. Although it is used in aquaculture[11] , there are only two known cases of Palometa being traded as aquarium fish between 1995 and 2000. Both reports came from Fortaleza, Ceará (Brazil),[12] but Palometa are rarely used for any other purpose than as a gamefish.

See also

References

  1. ^ IUCN 2007. 2007 IUCN Red List of Threatened Species. <http://www.iucnredlist.org>. Downloaded on 23 February 2008.
  2. ^ "Fishbase.org entry on Palometa". http://filaman.ifm-geomar.de/Summary/SpeciesSummary.php?id=1011. Retrieved 2008-04-07.
  3. ^ Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  4. ^ a b "Fishbase.org entry on Palometa". http://filaman.ifm-geomar.de/Summary/SpeciesSummary.php?id=1011. Retrieved 2008-04-02.
  5. ^ a b "myfwc.com entry on Palometa". http://myfwc.com/Marine/FishID/pomppalo.html. Retrieved 2008-04-06.[dead link]
  6. ^ Robins, C.R. and G.C. Ray, 1986. A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
  7. ^ IGFA, 2001. Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  8. ^ "myfwc.com entry on Palometa". http://myfwc.com/Marine/FishID/pomppalo.html. Retrieved 2008-03-28.[dead link]
  9. ^ Journal of Applied Aquaculture Volume: 7 Issue: 2, William M. Cole, James E. Rakocy, Kurt A. Shultz, John A. Hargreaves.
  10. ^ Dammann, A.E., 1969. Study of the fisheries potential of the Virgin Islands. Special Report. Contribution No. 1. Virgin Islands Ecological Research Station.
  11. ^ "Fishbase.org entry on Palometa". http://filaman.ifm-geomar.de/Summary/SpeciesSummary.php?id=1011. Retrieved 2008-04-11.
  12. ^ Monteiro-Neto, C., F.E.A. Cunha, M.C. Nottingham, M.E. Araújo, I.L. Rosa and G.M.L. Barros., 2003. Analysis of the marine ornamental fish trade at Ceará State, northeast Brazil. Biodivers. Conserv. 12:1287-1295.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!