Overview

Comprehensive Description

Biology

Adults form schools in clear coastal areas, usually near coral formations (Ref. 5217). Juveniles common in clean sandy beaches (Ref. 5217). Adults feed on crustaceans, polychaete worms, insect pupae, mollusks and fishes (Ref. 9626). Between 1995 and 2000, at least 2 specimens were traded as aquarium fish at Fortaleza, Ceará (Ref. 49392).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Trachinotus goodei is distributed in coastal waters around the western Atlantic from Massachusetts, east to Bermuda, and south to Argentina, including the Northern and Southern Gulf of Mexico, (McEachran and Fechhelm 2005) and the Caribbean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and the Gulf of Mexico to Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and the Gulf of Mexico to Argentina.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 19 - 20; Anal spines: 2 - 3; Analsoft rays: 16 - 18
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 560 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal and anal fins have very long, dark anterior lobes (Ref. 26938). Bluish silver on back, shading to silver on sides, with four narrow dark bars on upper of body (Ref. 13442).
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Trachinotus goodei is a coastal species found in sub-tropical climates at a depth range of 0–12 m. Adults of this species are usually found in clear coastal areas and in the surf zone along sandy beaches where they form large schools. They are also found around reefs and rocky areas (FAO 2002). Juveniles are common near clean, sandy beaches. This species is usually associated with high water salinity (FAO 2002). Trachinotus goodei feeds on crustaceans, polychaete worms, insect pupae, molluscs, and fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 12 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0 - 15
  Temperature range (°C): 26.770 - 27.724
  Nitrate (umol/L): 0.174 - 0.997
  Salinity (PPS): 34.217 - 36.993
  Oxygen (ml/l): 4.538 - 4.667
  Phosphate (umol/l): 0.051 - 0.169
  Silicate (umol/l): 1.862 - 2.813

Graphical representation

Depth range (m): 0 - 15

Temperature range (°C): 26.770 - 27.724

Nitrate (umol/L): 0.174 - 0.997

Salinity (PPS): 34.217 - 36.993

Oxygen (ml/l): 4.538 - 4.667

Phosphate (umol/l): 0.051 - 0.169

Silicate (umol/l): 1.862 - 2.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 12m.
Recorded at 12 meters.

Habitat: reef-associated. Adults and juveniles commonly forming large schools in the the surf zone and clear water along sandy beaches, around reefs and rocky areas. Occurs in large schools (Ref. 5521). Feeds on crustaceans, polychaete worms, insect pupae, molluscs and fishes (Ref. 9626).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults form schools in clear coastal areas, usually near coral formations (Ref. 5217). Juveniles common in clean sandy beaches (Ref. 5217). Feeds on crustaceans, polychaete worms, insect pupae, mollusks and fishes (Ref. 9626).
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachinotus goodei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGRATAGTAGGTACAGCTTTAAGCCTACTTATTCGAGCGGAGCTTAGTCAACCCGGCGCCCTCCTAGGAGATGACCAAATTTACAATGTAATCGTTACAGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTTATTCCACTAATGATTGGAGCTCCAGATATGGCATTCCCTCGAATGAATAACATGAGCTTCTGACTCCTCCCTCCCTCTTTTCTTCTCCTTCTTGCCTCCTCAGGAGTAGAAGCAGGTGCCGGAACCGGTTGAACAGTCTATCCCCCCTTAGCTGGTAATCTTGCCCATGCAGGAGCATCCGTTGATTTAACCATTTTCTCCCTTCACCTAGCTGGWWTTTCATCAATTCTAGGGGCTATCAACTTCATTACGACAGTAATCAACATAAAACCCCATGCTGTCTCTATATACCAGATCCCACTATTTGTCTGAGCCGTTCTAATTACAGCCGTCCTCCTGCTTCTCTCACTACCTGTTTTAGCCGCTGGCATTACAATACTTCTTACTGATCGAAACCTAAACACTGCCTTCTTTGACCCAGCCGGAGGAGGAGATCCCATCCTATACCAACACCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trachinotus goodei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M. (Sampled Red List Index Coordinating Team)

Reviewer/s
Carpenter, K.E., Livingstone, S. & Polidoro, B.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Trachinotus goodei has been listed as Least Concern. Although harvested for human consumption, this is not thought to be a major threat to the global population of this broadly distributed species. This species is also known to be farmed, which is likely to have reduced the impact of harvesting of this species from the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for Trachinotus goodei.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Trachinotus goodei is fished commercially, and is caught using seines and by sport fishers with hook-and-line. This species is not fished selectively and is found in Central and South American markets (FAO 2002). This species is also farmed for aquaculture, therefore commercial harvesting is unlikely to be a major threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Trachinotus goodei is farmed for aquaculture and may be bred in captivity for this purpose. The distribution of this species may fall within numerous marine protected areas. Monitoring of the harvest levels of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!