Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults are benthopelagic in outer reef slopes and offshore banks to 160 m or more. They form small groups (Ref. 9283, 26235, 58302). Young often seen around floating objects (Ref. 4887, 48635). They feed mainly on fishes, but also on invertebrates. Eggs are pelagic (Ref. 4233). Marketed fresh and salted or dried (Ref. 9283). May cause ciguatera poisoning, particularly in coral reef areas (Ref. 5217). Uncommon on East Indian reefs but occasionally found in cool upwelling areas of Lesser Sunda Islands of Indonesia (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seriola rivoliana ZBK Valenciennes in Cuvier & Valenciennes, 1833

An underwater photo of this common circumtropical species was taken by Pedro Vasconcelos at Sete Pedras.

  • Peter Wirtz, Carlos Eduardo L. Ferreira, Sergio R. Floeter, Ronald Fricke, Joao Luiz Gasparini, Tomio Iwamoto, Luiz Rocha, Claudio L. S. Sampaio, Ulrich K. Schliewen (2007): Coastal Fishes of Sao Tome and Principe islands, Gulf of Guinea (Eastern Atlantic Ocean) - an update. Zootaxa 1523, 1-48: 12-12, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:2202520B-A3E7-492D-A932-14463CD6DAF9
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: jack (English), amberjack (English), bojala (Espanol), hojarán (Espanol)
 
Seriola rivoliana Valenciennes in Cuvier and Valenciennes, 1833


Almaco jack,     Pacific amberjack



Elongate, fusiform, relatively deep, compressed; upper head & body profile distinctly more convex that lower profile; snout long, pointed; mouth ends under center of pupil, supramaxilla bone above top jawbone very wide; gill rakers (excluding rudiments) 22-26; dorsal fin with VII-VIII spines (front spines may be imbedded in very large fish), then a notch before I, 27-33; anal fin II isolated spines (reduced or embedded in large fish) + I, 18-22, its base much shorter than soft dorsal base; front rays of dorsal and anal fins elongate, in a curved point; no isolated finlets after dorsal and anal fins; pectoral short (< head length); tail base with grooves on dorsal and ventral surface of tail fin base, but no lateral fleshy keel; lateral line with slight arch over pectoral region; no scutes (hard spiny scales) on lateral line.



Bluish to greenish on upper back, silvery below; oblique dark band from snout to front of dorsal fin; juveniles (up to 20cm) with oblique dark bar on head and 7 dark bars on side and tail base.


Size: attains at least 157 cm, common to 60 cm; at least 60kg.

Habitat: demersal and pelagic, mainly oceanic.

Depth: 3-250 m.

Circumtropical, in the eastern Pacific from Southern California to the SW Gulf of California to Peru, and the oceanic islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Cape Cod, USA to northern Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal. Indo-West Pacific: Kenya south to South Africa (Ref. 3287) and east to Mariana and Wake islands in Micronesia, north to the Ryukyu Islands, south to New Caledonia and the Kermadec Islands (Ref. 8879). Absent from the Red Sea and French Polynesia. Likely at Seychelles (Ref. 1623). Eastern Pacific: USA to Peru, including Galapagos Islands (Ref. 2850). Western Atlantic: Cape Cod, USA to northern Argentina (Ref. 9626). Distribution in the eastern Atlantic is not well established. Recently recorded from Lampedusa Island in the Mediterranean (Ref. 47878).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas, including Mediterranean Sea, Mascarenes, New Caledonia, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 3 (S) - 250 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 27 - 33; Analspines: 3; Analsoft rays: 18 - 22
  • Smith-Vaniz, W.F. 1986 Carangidae. p. 638-661. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3197)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 157.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1100 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

160 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 59.9 kg (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Color highly variable when fresh. Dorsal brown or silvery blue-green to olivaceous, ventral paler or silvery with brassy or lavender reflections; vertical bar on nape dark; oblique stripe (may be absent), midlateral, yellow, amber or dark yellow brown, from eye or from mouth through eye to dorsal back profile near anterior dorsal fins; fins dark or yellowish grey except pelvic fins, white ventrally (Ref. 3197, 55763, 90102). Body elongated, moderately deep, slightly compressed; profile more convex on dorsal than ventral. Upper jaw posterior very broad, extends to level of middle of pupil. Gill rakers usually 6-9 + 18-20 = 24 -29 total gill rakers but 22 to 26 (excluding rudiments) in fish larger than 20 cm FL (Ref. 90102); first gill arch lower branch with 15 to 18 gill rakers in individuals greater than 20 cm SL (Ref. 55763). Supra-maxillary very wide. LL forms dermal keel on the caudal peduncle. Second dorsal fin anterior lobe deep; caudal peduncle with dorsal and ventral fossae (Ref. 55763). Dorsal fin lobe longer than pectoral fins 1.3 to 1.6 times and 18 to 22 % FL (Ref. 90102).
  • Smith-Vaniz, W.F. 1986 Carangidae. p. 638-661. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3197)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits outer reef slopes and offshore banks to depths of 160 or more; rarely found at depths less than 30 m in Micronesian waters. Pelagic but sometimes found near the substrate (Ref. 9626). Young often seen around floating objects at the sea (Ref. 4887). Can cause ciguatera poisoning especially during spawning season. Feeds mainly fishes, also invertebrates. Marketed fresh and salted/dried (Ref. 9283).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 245 m (Ref. 90102), usually 30 - 35 m (Ref. 40849)
  • Gasparini, J.L. and S.R. Floeter 2001 The shore fishes of Trindade Island, western South Atlantic. J. Nat. Hist. 35:1639-1656. (Ref. 40849)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 83 specimens in 1 taxon.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 0 - 1646
  Temperature range (°C): 4.196 - 26.874
  Nitrate (umol/L): 0.286 - 31.523
  Salinity (PPS): 33.952 - 36.430
  Oxygen (ml/l): 1.600 - 5.743
  Phosphate (umol/l): 0.088 - 1.861
  Silicate (umol/l): 0.868 - 28.123

Graphical representation

Depth range (m): 0 - 1646

Temperature range (°C): 4.196 - 26.874

Nitrate (umol/L): 0.286 - 31.523

Salinity (PPS): 33.952 - 36.430

Oxygen (ml/l): 1.600 - 5.743

Phosphate (umol/l): 0.088 - 1.861

Silicate (umol/l): 0.868 - 28.123
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 15 - 160m.
From 15 to 160 meters.

Habitat: benthopelagic. Inhabits outer reef slopes and offshore banks to 160 m or more; rarely found at depths less than 30 m in Micronesian waters. Pelagic but sometimes found near the substrate (Ref. 9626). Young often seen around floating objects (Ref. 4887). Feeds mainly on fishes, but also on invertebrates. May cause ciguatera poisoning especially during spawning season. Marketed fresh and salted/dried (Ref. 9283).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Near Surface, Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits outer reef slopes and offshore banks to 160 m or more (Ref. 26235); also found in coral reefs (Ref. 58534). Adults are pelagic and demersal (Ref. 9283). Young often seen around floating objects (Ref. 4887, 48635). Feeds mainly on fishes, but also on invertebrates. Piscivore (Ref. 57615). Feeds during the day and at night (diurnal and nocturnal) (Ref. 4887).
  • Honebrink, R. 1990 Fishing in Hawaii: a student manual. Education Program, Division of Aquatic Resources, Honolulu, Hawaii. 79 p. (Ref. 4887)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Seriola rivoliana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATCTAGTATTTGGTGCCTGAGCCGGCATGGTCGGTACAGCCCTAAGTTTACTCATCCGAGCAGAACTAAGTCAACCTGGAGCTCTCCTGGGAGACGATCAGATTTACAACGTAATCGTTACGGCACACGCGTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTCATCCCTTTAATGATTGGAGCTCCCGATATAGCATTCCCTCGAATGAACAATATGAGCTTCTGACTCCTCCCCCCTTCATTCCTTCTGCTCCTGGCCTCTTCAGGTGTTGAAGCCGGAGCCGGAACAGGTTGAACAGTTTACCCGCCCCTAGCCGGCAACCTTGCCCACGCAGGAGCATCCGTAGACTTAACGATTTTCTCTCTTCATCTAGCTGGGATCTCCTCAATTCTAGGAGCTATTAACTTTATCACAACCATCGTCAATATGAAACCCCACGCCGTTTCCATGTATCAAATTCCCCTGTTTGTCTGAGCTGTCCTAATTACGGCTGTGCTTCTACTCCTATCACTCCCAGTCCTAGCTGCCGGCATTACAATGCTTCTAACAGATCGAAACTTAAACACTGCCTTCTTCGACCCAGCTGGAGGGGGAGATCCTATCCTTTACCAACACCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Seriola rivoliana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Almaco jack

Almaco jack (Seriola rivoliana[1]) is a game fish of the family Carangidae; they are in the same family as yellowtail and amberjack.[2] They feed, both day and night, on other smaller fish such as baitfish and small squid. The flesh is thick and dense like tuna and can easily pass for white albacore if prepared as sushi.[2]

Taxonomy[edit]

An Almaco jack caught by a recreational fisherman

Achille Valenciennes, and Georges Cuvier first described the Almaco jack. The description was published in 1833 although Cuvier died in 1832. Valenciennes and Cuvier together described many fish species, most notably in the 22 volume Histoire naturelle des poissons, (Natural History of Fish).[1]

Description[edit]

The Almaco jack has a less elongated, more flattened body than most jack species. Their dorsal fin and anal fins are elongated, and their outer edges have a definite sickle shape. The first rays of the Almaco dorsal fin's longest parts are nearly twice as long as the dorsal spines, also different from other jacks.

They reach a typical length of 90 centimetres (35 in), sometimes reaching 160 centimetres (63 in) and 59.9 kilograms (132 lb).[1]

Almaco jacks are generally dusky-colored with faint amber or olive stripes down their sides. Their upper bodies and lower fins are usually dark brown or dark blue-green. The belly is much lighter and appears brassy or lavender. The nuchal bar and most of the fins is dark on adults. Exceptions are the pelvic fins which are white on the ventral sides.

Distribution and habitat[edit]

The Almaco jack is a pelagic species that can be found in small groups on slopes and off of reefs at depths from 5 to 160 metres (2.7 to 87.5 fathoms). They visit wrecks more often than most other jacks. In the Indian to the west Pacific oceans, Almaco jack live from Kenya to South Africa and have been spotted off Mariana Islands, Wake island, Ryukyu Islands, Kermadec Islands and New Caledonia. In the eastern Pacific, Almaco jack live from California to Peru and the Galapagos islands. In the western Atlantic, they live mostly from Cape Cod to northern Argentina although they are rare off North and South Carolina. Almaco jack are not as common in the Eastern Atlantic as elsewhere. Almaco live near Great Britain and off Lampedusa in the Mediterranean sea.[citation needed] They typically swim at depths ranging from 5–35 metres (16–115 ft).[1]

Behavior[edit]

Almaco jack's unusual stamina makes them a prime target for deep sea fishermen.

They remove skin-based parasites by rubbing against the rough skin of passing sharks. Almaco jack also rub against passing scuba divers because they mistake them for sharks.[3]

Breeding[edit]

These fish spawn as often as weekly throughout the year.[4]

Aquaculture[edit]

Almaco jacks are farmed/ranched near the Island of Hawaii under the brand name Kona Kampachi as a domesticated alternative to wild tuna. Global production reached 1,000,000 pounds (450,000 kg) in 2008.[2][5] Almaco jack can cause a disease in humans called ciguatera through bioaccumulation of ciguatoxin produced by a microscopic organism called dinoflagellate.[2] They have never been commercially harvested on a large scale and are abundant in the wild.[2] Farmed Almacos on a controlled diet are free of dinoflagellates.[2]

These fish have among the best feed-conversion ratios ever achieved. With no selective breeding at all, the amount of fish required to produce one pound ranges from 1.6:1-2:1, ten times better than the observed ratio for bluefin tuna. The resulting meat has a fat content of around 30%.[4]

They grow in diamond-shaped net pens moored to the sea bottom 800 feet (240 m) below. The area experiences strong currents that mitigates the impact of the waste that the fish drop.[4]

Notes[edit]

  1. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2006). "Seriola rivoliana" in FishBase. April 2006 version.
  2. ^ a b c d e f Greenberg 2010
  3. ^ Seriola rivoliana, Almaco Jack - MarineBio.org. Retrieved Monday, January 21, 2008, from http://marinebio.org/species.asp?id=442
  4. ^ a b c Greenberg 2010, 3171
  5. ^ "Kona Blue". Kona Blue Water Farms. Retrieved 2008-06-25. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!