Overview

Comprehensive Description

Biology

Inhabits coastal waters. Found in rocky or coral reefs (Ref. 9710). More abundant over muddy bottoms. Juveniles are encountered in seagrass beds (Ref. 9626). Often occurs in large schools, sometimes near the surface (Ref. 9626). Marketed fresh and frozen.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda, Florida (USA), and the Bahamas to Uruguay.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

61.0 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 1,140 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 65 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 100
  Temperature range (°C): 26.401 - 27.366
  Nitrate (umol/L): 0.435 - 0.949
  Salinity (PPS): 36.134 - 37.096
  Oxygen (ml/l): 4.668 - 4.706
  Phosphate (umol/l): 0.108 - 0.338
  Silicate (umol/l): 2.517 - 3.253

Graphical representation

Depth range (m): 0 - 100

Temperature range (°C): 26.401 - 27.366

Nitrate (umol/L): 0.435 - 0.949

Salinity (PPS): 36.134 - 37.096

Oxygen (ml/l): 4.668 - 4.706

Phosphate (umol/l): 0.108 - 0.338

Silicate (umol/l): 2.517 - 3.253
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 65m.
From 1 to 65 meters.

Habitat: reef-associated. Inhabits coastal waters. Found in rocky or coral reefs (Ref. 9710). More abundant over muddy bottoms. Juveniles are encountered in seagrass beds (Ref. 9626). Often occurs in large schools, sometimes near the surface (Ref. 9626). Marketed fresh and frozen.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coastal waters. Found in rocky or coral reefs (Ref. 9710). More abundant over muddy bottoms. Juveniles are encountered in seagrass beds (Ref. 9626). Often occurs in large schools, sometimes near the surface (Ref. 9626).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena picudilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCACTTAGCCTGCTCATTCGAGCTGAGCTAAGCCAACCAGGATCGCTTCTGGGGGACGACCAACTCTACAACGTAATTGTAACGGCACACGCTTTTGTAATAATCTTTTTTATGGTAATGCCCATCATAATTGGAGGATTTGGAAATTGACTTATCCCACTAATGATTGGGGCCCCGGACATGGCCTTCCCTCGGATAAATAATATAAGCTTTTGACTCCTTCCCCCCTCATTCCTGCTTCTGCTAGCCTCTTCAGCTGTAGAATCAGGCGCAGGGACAGGGTGAACGGTTTATCCCCCTTTATCTGCCAACTTGGCTCACGCCGGTGCATCTGTTGATCTCACAATTTTCTCCCTTCATTTAGCGGGAATTTCATCAATTCTAGGGGCCATTAACTTTATCACCACTATTATTAATATAAAACCAGCAATCACCTCAATATACCAAATTCCACTCTTTGTGTGATCTGTCCTGATTACTGCCATTCTTCTTCTCCTCTCGCTTCCTGTCCTGGCTGCCGGAATTACAATGCTGTTAACCGACCGAAATCTAAACACTGCATTTTTTGACCCTGCGGGAGGGGGGGACCCAATTCTGTACCAGCACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena picudilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern sennet

The southern sennet, Sphyraena picudilla', is an ocean-going species of game fish in the barracuda family, or Sphyraenidae. It was described by the Cuban zoologist Felipe Poey. The description was part of a two-volume work, which Poey published in 1860, entitled Historia Natural de la Isla de Cuba or Natural History of the Island of Cuba. Southern sennet are sometimes used as a food fish, and marketed either fresh or frozen.[1] Although they are generally harmless, Southern sennet have been linked to ciguatera poisoning.[2]

Contents

Description

Southern sennet, like other members of the Sphyraenidae family, possess elongated bodies, pike-like heads, and large jaws.[3] The lower jaw protrudes slightly from the upper jaw, both of which contain fang-like teeth.[3] They have two dorsal fins, which are widely separated on their backs. The anterior dorsal fin usually possesses spines, while the posterior only has rays.[3] Southern sennet have six spines, and 9 rays on their dorsal fins. they have only two spines and 9 rays on their anal fins.[1] The longest recorded southern sennet was 2 ft long;[4] the greatest recorded weight was 2 lbs 8 oz.[4]

Distribution and habitat

Southern sennet are known only from the western Atlantic Ocean from Bermuda, Florida, and the Bahamas south to Uruguay.[1] They are found in tropical climates from 32°N to 38°S. Southern sennet live in costal waters near reefs, although they are more common over muddy bottoms,[5] at depths from 1–65 m,[6] where they often occur in large schools near the surface.[6] Juveniles are commonly found over beds of seagrasses.[6]

References

  1. ^ a b c Froese, Rainer, and Daniel Pauly, eds. (2009). "Sphyraena picudilla" in FishBase. 07 2009 version.
  2. ^ Dammann, A.E. 1969 Study of the fisheries potential of the Virgin Islands. Special Report. Contribution No. 1. Virgin Islands Ecological Research Station.
  3. ^ a b c Froese, Rainer, and Daniel Pauly, eds. (2006). "Sphyraenidae" in FishBase. January 2006 version.
  4. ^ a b IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  5. ^ Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p.
  6. ^ a b c Cervigón, F. 1993 Los peces marinos de Venezuela. Volume 2. Fundación Científica Los Roques, Caracas,Venezuela. 497 p
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!