Overview

Comprehensive Description

Biology

A pelagic (Ref. 26340) schooling species usually found in offshore reefs (Ref. 9710). Juveniles are encountered along shores of sandy beaches, also over muddy bottoms (Ref. 9626). May penetrate into brackish water and ascend rivers. Adults feed on fishes, shrimps, and other invertebrates (Ref. 3277). Often approach divers (Ref. 9710). Eggs are pelagic (Ref. 4233).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caranx latus ZBK Agassiz, 1831

This species can commonly be seen in SãoTomé City fish market. It was also frequently observed and photographed, both at Príncipe and SãoTomé Islands. CAS 214558 (1 juv.) at mouth of Rio do Ouro, SãoTomé and CAS 214560 (1 juv.) at Rio Papagaios, Príncipe .

  • Peter Wirtz, Carlos Eduardo L. Ferreira, Sergio R. Floeter, Ronald Fricke, Joao Luiz Gasparini, Tomio Iwamoto, Luiz Rocha, Claudio L. S. Sampaio, Ulrich K. Schliewen (2007): Coastal Fishes of Sao Tome and Principe islands, Gulf of Guinea (Eastern Atlantic Ocean) - an update. Zootaxa 1523, 1-48: 12-12, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:2202520B-A3E7-492D-A932-14463CD6DAF9
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: New Jersey (USA), Bermuda, and northern Gulf of Mexico to Rio de Janeiro, Brazil. Also entire Caribbean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: New Jersey (USA), Bermuda, and northern Gulf of Mexico to São Paulo, Brazil (Ref. 57756). Eastern Atlantic: St. Paul's Rocks (Ref. 13121), Ascension Island, and two confirmed records from the Gulf of Guinea (Ref. 7097).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western annd eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 20 - 22; Anal spines: 2 - 3; Analsoft rays: 16 - 17
  • Randall, J.E. 1996 Caribbean reef fishes. Third Edition - revised and enlarged. T.F.H. Publications, Inc. Ltd., Hong Kong. 3nd ed. 368 p. (Ref. 13442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

101 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 13.4 kg (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No spots on pectoral fins, and the spot posteriorly on the gill cover is small or absent; the scutes tend to be dusky or blackish; caudal fin is yellow. The young have broad blackish bars on the body.
  • Randall, J.E. 1996 Caribbean reef fishes. Third Edition - revised and enlarged. T.F.H. Publications, Inc. Ltd., Hong Kong. 3nd ed. 368 p. (Ref. 13442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceano-estuarine (Ref. 4233); freshwater; brackish; marine; depth range 0 - 140 m (Ref. 36484), usually 0 - 20 m (Ref. 40849)
  • Gasparini, J.L. and S.R. Floeter 2001 The shore fishes of Trindade Island, western South Atlantic. J. Nat. Hist. 35:1639-1656. (Ref. 40849)
  • Smith-Vaniz, W.F. 1986 Carangidae. p. 815-844. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. UNESCO, Paris. vol. 2. (Ref. 4233)
  • Willoughby, S., J.D. Neilson and C. Taylor 1999 The depth distribution of exploited reef fish populations off the south and west coasts of Barbados. Proc. Gulf Caribb. Fish Inst. 45:57-68. (Ref. 36484)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 30 samples.

Environmental ranges
  Depth range (m): 0 - 717.5
  Temperature range (°C): 13.340 - 27.684
  Nitrate (umol/L): 0.311 - 15.450
  Salinity (PPS): 31.755 - 36.186
  Oxygen (ml/l): 3.839 - 4.845
  Phosphate (umol/l): 0.006 - 0.954
  Silicate (umol/l): 0.868 - 7.274

Graphical representation

Depth range (m): 0 - 717.5

Temperature range (°C): 13.340 - 27.684

Nitrate (umol/L): 0.311 - 15.450

Salinity (PPS): 31.755 - 36.186

Oxygen (ml/l): 3.839 - 4.845

Phosphate (umol/l): 0.006 - 0.954

Silicate (umol/l): 0.868 - 7.274
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Usually in small schools, most common around islands and offshore. Juveniles are encountered along shores of sandy beaches, also over muddy bottoms (Ref. 9626). May penetrate into brackish water and ascend rivers. Feeds on fishes, shrimps and other invertebrates (Ref. 3277). Often approaches divers (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A pelagic (Ref. 26340) schooling species usually found in offshore reefs (Ref. 9710). Juveniles are encountered along shores of sandy beaches, also over muddy bottoms (Ref. 9626). May penetrate into brackish water and ascend rivers. Often approach divers (Ref. 9710). Roving predator which patrol while swimming near the surface or at mid-water, lunging mainly at small fishes. Feed on benthic, rocky dweller fishes (Ref. 43310), shrimps, and other invertebrates (Ref. 3277). Seems to forage mainly at twilight (Ref. 40396).
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caranx latus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACCGCTTTAAGCTTACTCATCCGAGCAGAACTTAGTCAACCTGGCGCCCTTTTAGGAGACGACCAAATTTATAACGTAATTGTTACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTCGGAAACTGACTTATCCCTCTAATGATCGGAGCCCCTGACATGGCATTCCCCCGAATAAATAATATGAGCTTCTGACTTCTCCCTCCTTCCTTCCTCCTACTTTTAGCCTCTTCAGGGGTAGAAGCTGGAGCTGGGACAGGTTGAACTGTATATCCCCCATTAGCTGGTAATCTTGCCCATGCCGGAGCATCAGTAGATCTAACTATTTTCTCCCTTCATCTAGCAGGGGTTTCATCAATTCTGGGGGCTATTAACTTCATTACTACGATCATTAACATGAAACCGCCCGCAGTCTCAATATACCAAATCCCACTATTTGTTTGAGCCGTATTAATTACAGCTGTTCTTCTCCTTCTTTCCCTCCCAGTCTTAGCTGCTGGTATTACAATACTTCTTACAGATCGAAACCTAAACACCGCCTTCTTCGACCCAGCAGGGGGAGGGGATCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Caranx latus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Horse-eye jack

The horse-eye jack, Caranx latus, is a gamefish and minor commercial fish in the family Carangidae. It is also known as the big-eye jack, and is similar in appearance to the crevalle jack, although the head of the horse-eye jack is not as blunt. The horse-eye jack is known to feed on smaller fish and on many invertebrates, such as shrimp and crab.

Taxonomy and phylogeny[edit]

The horse-eye jack is classified within the genus Caranx, one of a number of groups known as the jacks or trevallies. Caranx itself is part of the larger jack and horse mackerel family Carangidae, a group of percoid fishes in the order Perciformes.[1]

The horse-eye jack was first scientifically described in 1831 by the Swiss naturalist Louis Agassiz based on a specimen collected from the waters of Brazil. Agassiz published this description, along with a further three carangids, in a volume co-authored with the German biologist Johann Baptist von Spix entitled Selecta Genera et Species Piscium Brasiliensium.[2] The specific epithet latus is Latin for 'broad', and may also refer to the flank of an animal. The new species was placed in the genus Caranx, with one subsequent revision reassigning the species to Xurel, now considered to be a junior synonym of Carangoides. In the same volume that C. latus was described, Agassiz also described Caranx lepturus,[2] which later examination revealed to be synonymous with C. latus. Due to C. latus being described first in the publication, this name takes priority and relegates C. lepturus to junior synonymy.[3] The species has been redescribed and named a further three times, all of which are similarly considered to be junior synonyms.[3][4] The horse-eye jack is similar in appearance to the bigeye trevally (Caranx sexfasciatus) of the Indo-Pacific region, causing the American ichthyologist John Nichols to describe C latus as a 'form' of C. sexfasciatus.[5] This analysis is no longer accepted, with the two species considered separate.

The horse-eye jack was included in a wide-ranging study of the molecular systematics of the Carangidae. In various analyses and models, C. latus always reliably placed in Caranx, being basal to a clade consisting of C. vinctus and C. caninus.[6]

The species is commonly known as the horse-eye jack or horse-eye crevalle in reference to the large eyes of the species. Other lesser used names include big-eye jack and false jack.[4]

Description[edit]

The horse-eye jack is a large fish, growing to a maximum recorded length of 101 cm and a weight of 13.4 kg, however is more common at lengths less than 60 cm.[4] The horse-eye jack has a body form similar to other large jacks found throughout its range, with a moderately compressed elongate and deep body.[7] The dorsal profile becomes more strongly curved anteriorly, however the forehead is less blunt than the crevalle jack. The eyes are large in proportion to the rest of the head and covered by a well-developed adipose eyelid, with the posterior extremity of the jaw vertically under or past the posterior margin of the eye.[7] The dorsal fin is in two parts, the first consisting of eight spines and the second of one spine followed by 19 to 22 soft rays. The anal fin consists of two anteriorly detached spines followed by one spine and 16 to 18 soft rays.[8] The lobes of the soft dorsal and anal fins are elongated, and the pectoral fin is falcate and longer than the length of the head. The lateral line has a pronounced and moderately long anterior arch.[8] The straight section contains 32 to 39 very strong scutes, with bilateral keels present on the caudal peduncle. The chest is completely scaled. The upper jaw contains a series of strong outer canines with an inner band of smaller teeth, while the lower jaw contains a single row of teeth.[7] The species has 22 to 25 gill rakers in total and 24 vertebrae are present. Like the crevalle jack, the horse-eye jack is known to develop hyperostosis in parts of its skeletal structure.[9]

Adult horse-eye jack are typically dark blue to silvery-blue above, becoming silvery white to golden below.[10] In some individuals the tip of the soft dorsal fin lobe and the scutes may be dark blue to black. The caudal fin is yellow to dusky in color.[11] Unlike the crevalle jack, there is no dark spot at the base of the pectoral fin, although but there may be dark spots on the gill covers. Juveniles exhibit a series of about five dark vertical bars on their flanks which fade with age.[7]

Distribution[edit]

The horse-eye jack is commonly found in the subtropical Atlantic ocean from Bermuda and the northern Gulf of Mexico and south to Rio de Janeiro. In the eastern Atlantic, it is found from St. Paul's Rocks to Ascension Island and, rarely, the in the Gulf of Guinea. It is a pelagic fish. It can be found on reefs and offshore oil rigs. The juvenile can be found closer to shore along sandy and muddy bottoms. The species may venture into brackish waters and can live in river mouths, but it is typically found in saltwater up to 140 m in depth.

The adult horse-eye jack commonly swims with others in a school, either as one species or mixed with crevalle jack. Sometimes it also swims as a pair with a member of a very different species, such as Halichoeres radiatus, a type of wrasse.

Interaction with humans[edit]

The fish is generally wary of scuba divers; it will move slowly away as divers approach. However, schools have been known to crowd around divers, apparently attracted to the bubbles the diver exhales.

References[edit]

  1. ^ "Caranx latus". Integrated Taxonomic Information System. Retrieved 29 June 2013. 
  2. ^ a b Spix, J.B. von; Agassiz, L. (1831). Selecta genera et species piscium quos in itinere per Brasiliam annos MDCCCXVII-MDCCCXX jussu et auspiciis. p. 374. 
  3. ^ a b California Academy of Sciences: Ichthyology (June 2013). "Caranx latus". Catalog of Fishes. CAS. Retrieved 2013-06-13. 
  4. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2013). "Caranx latus" in FishBase. June 2013 version.
  5. ^ Nichols, J. (1938). "Notes on Carangin Fishes III - On Caranx sexfasciatus Quoy and Gaimard". American Museum Novitates 998: 1–6. Retrieved 28 June 2013. 
  6. ^ Reed, David L.; Carpenter, Kent E. & deGravelle, Martin J. (2002). "Molecular systematics of the Jacks (Perciformes: Carangidae) based on mitochondrial cytochrome b sequences using parsimony, likelihood, and Bayesian approaches". Molecular Phylogenetics and Evolution 23 (3): 513–524. doi:10.1016/S1055-7903(02)00036-2. PMID 12099802. 
  7. ^ a b c d Carpenter, K.E. (ed.) (2002). The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. FAO Species Identification Guide for Fishery Purposes and American Society of Ichthyologists and Herpetologists Special Publication No. 5. Rome: FAO. p. 1438. ISBN 92-5-104827-4. 
  8. ^ a b Fischer, W; Bianchi, G. & Scott, W.B. (1981). FAO Species Identification Sheets for Fishery Purposes: Eastern Central Atlantic Vol 1. Ottawa: Food and Agricultural Organization of the United Nations. 
  9. ^ Smith-Vaniz, W.; L. S. Kaufman & J. Glowacki (1995). "Species-specific patterns of hyperostosis in marine teleost fishes". Marine Biology 121 (4): 573–580. doi:10.1007/BF00349291. 
  10. ^ Edward, O.; Musick, J.A. & Kells, V.A. (2013). Field Guide to Fishes of the Chesapeake Bay. Johns Hopkins University Press. p. 360. ISBN 978-1421407685. 
  11. ^ Schultz, Ken (2004). Ken Schultz's Field Guide to Saltwater Fish. John Wiley and Sons. p. 288. ISBN 978-0-471-44995-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!