Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

The live shark sucker lives on the bounty of its fellow sea creatures, depending on other animals to live. A bad swimmer, it needs to attach to another animals—usually sharks, but also large fish, stingrays, sea turtles, dolphins, whales, and even the legs of people—if it wants to get around. Don’t worry though; its sucking disc isn’t painful.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Echeneis naucrates Linnaeus, 1758

Aegean Sea : 13100-248 (1 spc.), 15.06.1968 , Sigacik Bay , M. Demir . Mediterranean Sea : 13100-790 (1 spc.), October 2002 , Iskenderun Bay , trawl , C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 44-44, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

  Common names: sharksucker (English), rémora (Espanol)
 
Echeneis naucrates Linnaeus, 1758


Live sharksucker



Body long & slender; head disc with 23 (18-28) plates, reaches over ~center of pectoral fin;  lower gill rakers 11-16 (not including rudiments); dorsal and anal fin bases long, 2-3 times head length; dorsal rays 39 (34-42); anal rays 36 (31-41);  pectoral rays 21-24; tail fin slightly rounded.


Grey, white edged black stripe along side from tip of lower jaw through eye to tail fin, stripe broader at front; tips of dorsal, anal and tail fins white.


Size: reaches 100 cm.

Often see around reefs. Attaches to a variety of hosts, including sharks, rays, large fishes, turtles and whales, but frequently free-living.

Depth: 0-50 m.

Circumtropical; throughout our region except the Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Most abundant remora in warm waters (Ref. 4389). Occurs near as well as far from the coast (Ref. 5217). Often found free-swimming in shallow inshore areas and around coral reefs (Ref. 26938). Attaches temporarily to a variety of hosts including sharks, rays, large bony fishes or sea turtles, whales, dolphins and also to ships. May follow divers (Ref. 9710); reported to attach itself to a diver's leg (Ref. 57809). Feeds on small fishes, bits of its host's prey and host's parasites (Ref. 26938). Juveniles occasionally act as reef station-based cleaners, where they service parrotfishes (Ref. 40095). Sometimes used by natives to aid in fishing; a line is tied to the caudal peduncle of the remora and then is released; upon attaching to another fish, the remora and its host are hauled in by the fisher (Ref. 9682).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

A funny looking fish, the live sharksucker sports a large sucking disc on the top of its head! It uses this sucker to attach to other animals, usually sharks. It spends its days hitching a ride with a shark and eating the scraps of food it leaves behind. Since the live sharksucker gets a free ride and free food, without harming or benefiting the shark, their relationship is called commensalism. This is a symbiotic, or close, relationship, in which one animal benefits, and the other is neither helped nor harmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circumtropical; Western Atlantic: Nova Scotia, Canada and Bermuda to Uruguay
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumtropical. Western Atlantic: Nova Scotia, Canada and Bermuda to Uruguay (Ref. 7251, 26938). Eastern Central Atlantic: Madeira Island (Ref. 74541).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sharksuckers, also known as remora, are commonly found in all warm seas. Sharksuckers have been found in the Western Atlantic, from Nova Scotia, Canada through Bermuda and the Gulf of Mexico, to Uruguay. They are found in the Mediterranean Sea. Their presence has also been reported in the Pacific Ocean, north to San Francisco, and Indian Ocean (Tarleton 1903).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and subtropical seas, including Mediterranean Sea, Black Sea, Red Sea, Mascarenes, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumtropical. Western Atlantic: Nova Scotia, Canada and Bermuda to Uruguay.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley., 1989; Lieske, E. and R. Myers, 1994; Smith, C.L., 1997; Heemstra, P.C., 1986; Collette, B.B., 1997; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 50 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 32 - 42; Analspines: 0; Analsoft rays: 29 - 41
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Echeneis naucrates can be easily spotted due to the sucking disc on top of its head. Its sucking organ consists of numerous pairs of crests, which originated from a highly modified spiny dorsal fin. This sucking disc is capable of producing a strong vacuum that the species uses to attach to their hosts. The fish is usually 11 or 12 times as long as it is wide, and about five and a half times the length of its head. The slim body usually has a dark stripe on the side with narrower pale edges (Field 1998). The sharksucker's tail is pointed, and the jaw is protruded. Echeneis naucrates' pectoral and ventral fins are dark in color, and the belly is a dark brownish color. The dorsal and anal fins are black, and are outlined with a lighter shade. Sharksuckers can reach approximately 100 centimeters in length, yet smaller ones are found more frequently. Adult females and males are difficult to distinguish. After the formation of the sucking disc, the young start to resemble the adults (Bigelow 1953).

Average mass: 2.01 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 100.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1100 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

110 cm TL (male/unsexed; (Ref. 9710)); max. published weight: 2,300 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 110 cm TL (male/unsexed); max.weight: 2,010 g.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley., 1989; Lieske, E. and R. Myers, 1994; Smith, C.L., 1997; Heemstra, P.C., 1986; Collette, B.B., 1997; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Often found free-swimming in shallow inshore waters. Attaches temporarily to a variety of hosts including sharks, rays, large bony fishes or sea turtles, whales, dolphins and also to ships. Sometimes used by natives to aid in fishing: a line is tied to the caudal peduncle of the remora and then is released; upon attaching to another fish, the remora and its host are hauled in by the fisherman (Ref. 9682).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

With a dark mid-lateral stripe bordered by narrow white stripes above and below (Ref. 26938). Body depth contained in 8-14 times in SL; caudal fin in adults almost truncate with the upper and lower lobes longer than the middle rays; first dorsal fin replaced by a transversal, laminated, oval cephalic disc with 18-28 laminae (Ref. 10970); 21-28 laminae (according to K.R. Sreenath (pers. comm, 11/2010; lecologiste@gmail.com) .
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most abundant remora in warm waters. Occurs near as well as far from the coast. Often found free-swimming in shallow inshore areas and around coral reefs. Attaches temporarily to a variety of hosts including sharks, rays, large bony fishes or sea turtles, whales, dolphins and also to ships.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 20 - 50 m (Ref. 28016)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Echeneis nacurates are often present in shallow inshore brackish areas, as well as around coral reefs. They are found at depths ranging from 20-50 meters, which is where the coral reefs are located (Humann 1994).

There have also been sightings of E. nacurates near Long Island, New Jersey, Massachusetts, and traveling up the Hudson River attached to a host (Smith 1997).

Aquatic Biomes: reef ; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 927 specimens in 1 taxon.
Water temperature and chemistry ranges based on 359 samples.

Environmental ranges
  Depth range (m): 0.8 - 1080
  Temperature range (°C): 5.433 - 28.529
  Nitrate (umol/L): 0.004 - 32.999
  Salinity (PPS): 33.112 - 39.819
  Oxygen (ml/l): 0.447 - 5.755
  Phosphate (umol/l): 0.083 - 2.579
  Silicate (umol/l): 0.380 - 80.911

Graphical representation

Depth range (m): 0.8 - 1080

Temperature range (°C): 5.433 - 28.529

Nitrate (umol/L): 0.004 - 32.999

Salinity (PPS): 33.112 - 39.819

Oxygen (ml/l): 0.447 - 5.755

Phosphate (umol/l): 0.083 - 2.579

Silicate (umol/l): 0.380 - 80.911
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 50m.
From 20 to 50 meters.

Habitat: reef-associated. Most abundant remora found in warm waters (Ref. 4389). Often found free-swimming in shallow inshore areas. Attaches temporarily to a variety of hosts including sharks, rays, large bony fishes or sea turtles, whales, dolphins and also to ships. May follow divers (Ref. 9710). Sometimes used by natives to aid in fishing; a line is tied to the caudal peduncle of the remora and then is released; upon attaching to another fish, the remora and its host are hauled in by the fisher (Ref. 9682).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reef-associated; brackish; marine ; depth range 20 - 50 m. Most abundant remora in warm waters . Coastal and offshore. Often found free-swimming in shallow inshore areas and around coral reefs . Attaches temporarily to a variety of hosts including sharks, rays, large bony fishes or sea turtles, whales, dolphins and also to ships. May follow divers.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley., 1989; Lieske, E. and R. Myers, 1994; Smith, C.L., 1997; Heemstra, P.C., 1986; Collette, B.B., 1997; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Near Surface, Mid Water, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Water column, Large fishes (billfishes, rays, sharks, etc), turtles & whales

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Most abundant remora in warm waters (Ref. 4389). Occurs near as well as far from the coast (Ref. 5217). Often found free-swimming in shallow inshore areas and around coral reefs (Ref. 26938, 58534). Attaches temporarily to a variety of hosts including sharks, rays, large bony fishes or sea turtles, whales, dolphins and also to ships. May follow divers (Ref. 9710). Feeds on small fishes, bits of its host's prey and host's parasites (Ref. 26938). Juvenile occasionally acts as reef station-based cleaners, where they service parrotfishes (Ref. 40095). Free-swimming or attached to host, most often to sharks. Feeds on zooplankton, benthic organisms and detritus (Ref. 33). Acts as cleaners of several species of reef fishes (Ref. 40095). Sometimes used by natives to aid in fishing; a line is tied to the caudal peduncle of the remora and then is released; upon attaching to another fish, the remora and its host are hauled in by the fisher (Ref. 9682).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The usual diet of sharksuckers is composed of scraps of food that are lost or rejected by the large host animal it is attached to. The fish also feed on small crustacean parasites that invade the skin of the host, and supplement their diet with other free living small crustacea, fishes, crabs and squid (Field 1998).

In captivity, the fish usually remain stationary on the bottom with the head slightly raised, and will rise to the surface to take pieces of clam or fish from the hand (Tarleton 1903).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on small fishes, bits of its host's prey and host's parasites.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley., 1989; Lieske, E. and R. Myers, 1994; Smith, C.L., 1997; Heemstra, P.C., 1986; Collette, B.B., 1997; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore, Planktivore, Ectoparasite cleaner

Diet: Pelagic crustacea, zooplankton, ectoparasites, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

What the live sharksucker eats depends on what its host eats, though its meals usually consist of scraps of fish. It also likes to eat small fish or microscopic animals in the water, and occasionally feels independent enough to find its own food. Since it only eats other animals, it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Dionchus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on small fishes, bits of its host's prey and host's parasites
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Not a lot is known about the reproduction patterns of sharksuckers. Spawning occurs in the warm seasons, spring and early summer in most of its range, and during the autumn in the Mediterranean. The sexes are separate, sperm and eggs develop in male and female individuals. In males, sperm passes from the testis to the outside by a specially developed duct (Lagler et al. 1962). Eggs are fertilized externally then enclosed in a hard shell, which protects them from damage and drying. The eggs can still hatch after they have been washed onto the shore, due to the protective shell that forms around them. Eggs are large, pelagic and spherical in shape. Newly-hatched E. naucrates are 4.7-7.5 mm long, have a large yolk sac, non-pigmented eyes, and an incompletely formed body. Immature fish live freely for approximately one year until they are about 3 cm in length, which is when they attach themselves to a host fish. When the newly-hatched E. naucrates are still developing, the sucking device begins forming. Also, the fish develop small teeth on the upper jaw, and large teeth on the lower jaw. The fish reach sexual maturity within three to five years (Lagler et al. 1962).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

no information.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley., 1989; Lieske, E. and R. Myers, 1994; Smith, C.L., 1997; Heemstra, P.C., 1986; Collette, B.B., 1997; Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Echeneis naucrates

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Echeneis naucrates

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTCGGGGCCTGAGCCGGAATAGTAGGAACCGCACTAAGCTTACTCATTCGGGCAGAACTTAGTCAACCAGGCTCATTATTAGGTGATGATCAGATTTATAATGTTATCGTCACAGCACATGCCTTTGTAATAATTTTCTTTATAGTTATACCAGTAATGATTGGAGGTTTTGGTAATTGATTAGTACCTCTTATAATTGGTGCACCAGACATAGCCTTCCCTCGAATAAATAATATAAGCTTCTGACTACTGCCTCCTTCCTTCCTCCTACTGCTAACATCTTCAGGAGTAGAAGCAGGAGCAGGAACTGGTTGAACTGTTTATCCTCCTTTAGCCGGAAACCTTGCCCATGCAGGAGCATCTGTTGACCTAACTATCTTTTCACTTCATCTGGCAGGAWTTTCCTCAATTCTTGGAGCAATTAATTTTATTACAACAATCATTAATATGAAACCTGCAGCTGCTTCTATATATCAACTCCCATTATTTGTATGAGCCGTATTAATTACAGCAGTTCTTCTTCTCCTATCCCTCCCTGTTTTAGCTGCTGGAATTACAATACTACTAACAGACCGTAATCTTAATACCGCCTTCTTTGATCCTGCAGGAGGGGGAGATCCCATCCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Echeneis naucrates are not listed in IUCN, CITES appendices, or the United States Endangered Species Act list.

Sharksuckers are very common in various oceans. They interact with many other organisms and depend on them for survival (Tarleton 1903).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

There are no direct threats to the live sharksucker, but when people hunt sharks, they sometimes kill live sharksuckers, too! Shark populations are dropping around the world, which is really bad news for live sharksuckers.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Sharksuckers attach with their powerful sucking disc to the bottoms of boats and occasionally to swimmers, causing damage to the boat and maybe even sinking it if the damage is severe enough. Even though very few instances were reported where Echeneis naucrates attached to humans, one can imagine how extremely painful it would be to have the numerous sharp ridges of the sucker clinging onto the human body (Debelius 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past Echeneis naucrates have been used as an aid in fishing. The fishermen tied lines to the remora and then released them into the deep sea. Since sharksuckers are always on the lookout to attach to a host, they behaved in the same matter when the fishermen dropped them into the water. When the remora found a suitable host and attached to it, the fishermen would haul the line, pulling the sharsucker along with its host onto land. Using E. naucrates as bait is a very intelligent and quick way of capturing bigger edible fish that the remora clings to. This benefits humans because normally hard-to-catch sea organisms are acquired easily (Humann 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Live sharksucker

The live sharksucker or slender sharksucker, Echeneis naucrates, is a species of marine fish in the family Echeneidae, the remoras.[1][2][3][4]

Distribution and habitat[edit]

The species is considered as circumtropical, as it occurs in all tropical and warm temperate waters around the world.[5]

The species can be found close to the coast, as well as offshore at a maximum depth of 50 m (160 ft).[6][7]

A live sharksucker is known to attached itself temporarily by its modified dorsal fin used as a sucking disc to various hosts, such as sharks, rays, large bony fishes, sea turtles, whales, dolphins, ships, and even sometimes scubadivers.[8]

Description[edit]

Echeneis naucrates is a medium-sized fish which can grow up 110 cm (43 in) length.[9] Its body is elongated and streamlined, and its lower jaw is clearly prognathic(it projects forward well beyond the upper jaw).[2] The jaws, vomer and tongue have villiform teeth.[2] The main distinctive feature to distinguish from other fishes is the oval-shaped sucking disc, which is a highly modified dorsal fin positioned from the top of the head to the anterior part of the body.[2]

The body background colouration is dark grey to dark brown, with a dark belly. A longitudinal stripe runs along the axis side of the body, it is always darker than its background colourwith a whitish margin. The caudal fin is black with white corners.

Diet[edit]

According to its maturity or its situation, with a hosts or not, the remora's diet varies.

As a juvenile, it sometimes acts as a cleaner fish on reef station and its diet consists of small parasitic crustaceans living on the fishes' bodies, like copepods, isopods, and ostracods.[10]

With a host, the live sharksucker eats parasitic crustaceans from the latter, food scraps from the feeding activity of its host, or some small food caught by filtering the water through its villiform teeth while the navigating on its host.[11]

Without a host, the fish stays close to the shore and can aggregate with other individuals; its diet is then composed of free-living crustaceans, squid, and small fishes.[11]


Taxonomic synonyms[edit]

References[edit]

  1. ^ http://www.fishbase.org/comnames/CommonNamesList.php?ID=2467&GenusName=Echeneis&SpeciesName=naucrates&StockCode=2661
  2. ^ a b c d http://australianmuseum.net.au/Slender-Suckerfish-Echeneis-naucrates-Linnaeus-1758/
  3. ^ http://australianmuseum.net.au/Slender-Suckerfish-Echeneis-naucrates-Linnaeus-1758/http://www.flmnh.ufl.edu/fish/Gallery/Descript/LiveSharksucker/LiveSharksucker.html
  4. ^ http://www.flmnh.ufl.edu/fish/Gallery/Descript/LiveSharksucker/LiveSharksucker.html
  5. ^ "Echeneis naucrates, Linnaeus, 1758". FishBase. October 6, 2011. Retrieved September 7, 2011. 
  6. ^ Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992. Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD.
  7. ^ al Sakaff, H. and M. Esseen, 1999. Occurrence and distribution of fish species off Yemen (Gulf of Aden and Arabian Sea). Naga ICLARM Q. 22(1):43-47.
  8. ^ http://www.fishbase.org/summary/2467
  9. ^ Lieske, E. and R. Myers, 1994. Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p.
  10. ^ Sazima, I., R.L. Moura and M.C.M. Rodrigues, 1999. Juvenile sharksucker, Echeneis naucrates (Echeneidae), acting as a station-based cleaner fish. Cybium 23(4):377-380.
  11. ^ a b http://doris.ffessm.fr/fiche2.asp?fiche_numero=2349
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!