Overview

Comprehensive Description

Biology

Normally occurs in rubble areas. Feeds on various types of algae. Oviparous (Ref. 205), monogamous (Ref. 52884). Retreats into holes when frightened (Ref. 9710). Has been reared in captivity (Ref. 35408).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species ranges from Bermuda, to Florida (USA), the Bahamas, and the southern Gulf of Mexico to northern South America. Found at depths of 5-80 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda and Florida, USA to French Guiana, including the Gulf of Mexico and the Caribbean Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14 - 15; Dorsal soft rays (total): 15 - 16; Analspines: 3; Analsoft rays: 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Deep blue, the head and chest orange-yellow; a narrow blue ring around eye; a small dark blue smudge just behind corner of mouth; pectoral fins pale yellowish; other fins deep blue with pale blue margins (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Associated with reef and rocky regions in warm waters. Prefers depths of 30 m or more, but can be found in moderate numbers in much shallower waters. Moderately secretive and territorial, but inquisitive. Feeds on algae and small benthic invertebrates (Burgess 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 5 - 80 m (Ref. 9626), usually 5 - 30 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 80m.
From 5 to 80 meters.

Habitat: reef-associated. Normally occurs in rubble areas. Feeds on various types of algae. Retreats into holes when frightened (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 11 - 1025
  Temperature range (°C): 7.090 - 27.482
  Nitrate (umol/L): 0.122 - 21.935
  Salinity (PPS): 35.107 - 36.618
  Oxygen (ml/l): 3.453 - 5.147
  Phosphate (umol/l): 0.028 - 1.415
  Silicate (umol/l): 0.799 - 14.234

Graphical representation

Depth range (m): 11 - 1025

Temperature range (°C): 7.090 - 27.482

Nitrate (umol/L): 0.122 - 21.935

Salinity (PPS): 35.107 - 36.618

Oxygen (ml/l): 3.453 - 5.147

Phosphate (umol/l): 0.028 - 1.415

Silicate (umol/l): 0.799 - 14.234
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge argi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTGCTATTCGGTGCTTGAGCTGGTATAGTAGGGACGGCTTTAAGCCTGCTTATCCGAGCTGAACTTAATCAGCCCGGCAGCCTCCTTGGAGACGACCAGATTTATAATGTTATCGTAACAGCACATGCGTTTGTAATAATCTTCTTTATGGTAATACCAGCCATAATCGGAGGATTTGGAAACTGATTAATTCCACTAATGATTGGGGCACCAGATATGGCGTTCCCTCGAATGAATAACATGAGCTTTTGACTCCTTCCTCCCTCCCTCCTCCTTCTCTTAGCTTCTGCTGGCGTAGAAGCCGGGGCCGGTACTGGATGAACAGTGTATCCCCCACTAGCCGGCAACTTAGCTCACGCAGGAGCATCCGTAGACCTGACCATCTTCTCCCTCCACTTAGCAGGGGTCTCCTCAATTCTAGGGGCTATTAATTTCATTACTACAATTATTAATATGAAACCCCCCGCTATTTCCCAGTACCAAACACCTTTATTTGTTTGAGCAGTCCTGATTACCGCAGTTCTACTACTCCTTTCCCTCCCAGTCCTTGCTGCAGGTATTACAATGCTTCTTACAGACCGAAACCTCAACACTACCTTTTTTGACCCCGCAGGTGGAGGAGACCCGATTCTTTACCAACATCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge argi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Although this species is collected for the aquarium trade it is not believed to have a significant impact on the population, the species is widely distributed and generally common throughout its range, therefore it is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is not common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection is relatively limited and is not considered to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is believed to be present within a number of marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cherubfish

The cherubfish, or pygmy angelfish (Centropyge argi) is a gentle omnivorous marine angelfish, with a metallic blue body and yellow to orange colouration in parts of the head only. It is native to the Caribbean and Gulf of Mexico, and has a maximum length of 8 cm. It is easily confused with the orangeback angelfish (Centropyge acanthops), but in the latter the orange stripe extends across the back.

When kept in an aquarium, cherubfish are distributed throughout the tank. They prefer reef tanks to fish only tanks. But like other angel fish, they are not completely 100% reef-safe. Results vary among individual fish and tank qualities (size, feeding, tankmates, etc.), so caution is recommended when adding this fish to a coral tank.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!