Overview

Comprehensive Description

Biology

Inhabit coral reefs. Occur singly or in pairs. Feed on polychaete worms, coral polyps, crustaceans and mollusk eggs. Oviparous (Ref. 205), monogamous (Ref. 52884). Form pairs during breeding (Ref. 205). Adults may form plankton-feeding aggregations of up to 20 individuals, and occasionally clean other reef fishes which join the group, such as grunts, parrotfishes and surgeon fishes. (Ref: 40093). Generally common (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Massachusetts, USA to Santa Catarina, Brazil (Ref. 57756), including the Gulf of Mexico and Caribbean Sea. Eastern Central Atlantic: St. Paul's Rocks (Ref. 13121).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widely distributed in the Caribbean from Florida and Gulf of Mexico to Rio de Janeiro, Brazil. Strays north to Massachusetts (Allen 1980) and has been reported from the eastern Atlantic. Also recorded from Bermuda (Carpenter 2002). It is known from 2-55 m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts, USA to Rio de Janeiro, Brazil, including the Gulf of Mexico and Caribbean Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic and St. Paul's Rocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 19 - 21; Analspines: 3; Analsoft rays: 16 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 160 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

With two broad black bars on side of body and a third bar basally in soft portion of dorsal fin which extends onto caudal peduncle; broad black submarginal bands in the median fins; pelvic fins black except for the spine (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 55 m (Ref. 13121), usually 5 - 20 m (Ref. 13121)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits rocky and coral reefs and can occur singly or in pairs. The diet is diverse, consisting of polychaete worms, coral polyps, crustaceans and mollusc eggs. Animals are monogamous (Whiteman and Côté 2004), forming pairs during breeding (Breder and Rosen 1966). Adults may form plankton-feeding aggregations of up to 20 individuals, and occasionally clean other reef fishes which join the group, such as grunts, parrotfishes and surgeon fishes (Sazima and Sazima 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 712 specimens in 1 taxon.
Water temperature and chemistry ranges based on 535 samples.

Environmental ranges
  Depth range (m): 0.25 - 63
  Temperature range (°C): 23.282 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 37.190
  Oxygen (ml/l): 4.285 - 4.748
  Phosphate (umol/l): 0.047 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.25 - 63

Temperature range (°C): 23.282 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 37.190

Oxygen (ml/l): 4.285 - 4.748

Phosphate (umol/l): 0.047 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 55m.
From 3 to 55 meters.

Habitat: reef-associated. Inhabits coral reefs. Occurs singly or in pairs. Feeds on polychaete worms, coral polyps, crustaceans and mollusc eggs. Generally common (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit coral reefs. Occur singly or in pairs. Form pairs during breeding (Ref. 205). Feed on polychaete worms, coral polyps, crustaceans and mollusk eggs. Sessile invertebrates feeder (Ref. 57616). Adults may form plankton-feeding aggregations of up to 20 individuals, and occasionally clean other reef fishes which join the group, such as grunts, parrotfishes and surgeon fishes. (Ref: 40093). Combination of plankton-feeding aggregation and occasional cleaning occur but possibly very localised in space and time (Ref. 40093).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon striatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCTATCTAGTATTTGGTGCTTGAGCTGGGATGGTAGGCACTGCCTTAAGTCTGCTCATCCGAGCAGAACTCAGCCAGCCAGGCACCCTCCTAGGCGACGATCAGATTTATAATGTAATCGTTACGGCACATGCGTTCGTAATGATTTTCTTTATAGTAATACCGATCATGATTGGGGGATTTGGGAATTGACTAATTCCCTTAATGATTGGGGCTCCGGACATGGCCTTCCCTCGAATAAATAACATAAGCTTTTGACTTCTCCCTCCATCCTTTTTCCTACTTCTTGCCTCCTCTGGCGTAGAGTCCGGGGCCGGCACTGGGTGAACAGTCTATCCCCCGCTGGCGGGTAATCTAGCCCACGCCGGGGCATCCGTTGATTTAACTATTTTCTCCCTTCACCTTGCAGGGATCTCCTCTATTCTAGGGGCTATTAATTTTATTACGACAATCCTTAACATGAAACCCCCTGCTATGTCTCAGTATCAAACTCCCCTTTTCGTCTGATCTGTCTTAATTACAGCCGTTCTACTTCTCTTGTCCCTCCCCGTTCTTGCAGCCGGAATTACAATACTCCNTACAGATCGAAACCTCAATACAACCTTCTTTGACCCTGCGGGGGGCGGCGATCCCATTCTTTACCAACATCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon striatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Rocha, L.A.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This is a wide ranging species that can be locally abundant. It is occasionally traded in aquarium shops, but given its wide range, harvesting for trade is not considered a major threat. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is generally a common species throughout its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No apparent major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In view of the species' wide range, populations are present within several marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Banded butterflyfish

The banded butterflyfish (Chaetodon striatus) is a butterflyfish found in the western Atlantic Ocean from Brazil to Bermuda.

The name is derived from the dark vertical bands on the fish's body. This, combined with a vertical, black bar through the eye, is designed to confuse predators.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!