Overview

Comprehensive Description

Biology

Inhabit shallow, coral reefs with clear water (Ref. 9626). Develop dusky bands at night. Generally common (Ref. 9710). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Florida, USA to Brazil. Larvae are sometimes swept northward which accounts for the sighting of juvenile specimens as far north as Massachusetts, USA during summer months. One record (one specimen, 3 cm) from Musquodoboit Harbor, Nova Scotia, Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species has been recorded from New England south to Brazil, including the Gulf of Mexico and Bermuda. Larvae are carried north in the Gulf Stream, but recruits do not survive the winter (Carpenter 2002). It is found from 1-30 m depth. There is one record (one specimen, 3 cm) from Musquodoboit Harbor, Nova Scotia, Canada (Allen 1980).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: 43.35°N to Florida, USA to Brazil; also Bahamas, Gulf of Mexico and Caribbean, including Antilles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 14; Dorsal soft rays (total): 18 - 21; Analspines: 3; Analsoft rays: 15 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body is white with a black bar running across the head through the eye. In juveniles, a second black bar runs from the base of the soft portion of the dorsal fin to the base of the anal fin. The dorsal, caudal and anal fins are either yellow or transparent (Ref. 4855). A narrow yellow bar from gill opening to pectoral base (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Spotfin butterflyfish. Attains 20 cm. Shallow reefs 3 - 28 metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 30 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is predominantly a shallow coral and rocky reef species feeding on various benthic invertebrates. It occurs commonly in pairs (Carpenter 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits shallow, coral reefs with clear water.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 494 specimens in 1 taxon.
Water temperature and chemistry ranges based on 340 samples.

Environmental ranges
  Depth range (m): 0 - 79
  Temperature range (°C): 22.695 - 28.067
  Nitrate (umol/L): 0.185 - 3.505
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 4.285 - 4.855
  Phosphate (umol/l): 0.046 - 0.344
  Silicate (umol/l): 0.756 - 5.080

Graphical representation

Depth range (m): 0 - 79

Temperature range (°C): 22.695 - 28.067

Nitrate (umol/L): 0.185 - 3.505

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 4.285 - 4.855

Phosphate (umol/l): 0.046 - 0.344

Silicate (umol/l): 0.756 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit shallow, coral reefs with clear water (Ref. 9626, 57616). Develop dusky bands at night. Generally common (Ref. 9710). Browser (Ref. 33499).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Hurleytrematoides Infestation 8. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hurleytrematoides Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon ocellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCTACCTAGTATTTGGTGCTTGAGCTGGGATGGTAGGCACCGCCTTAAGTCTGCTCATCCGAGCAGAACTTAGCCAGCCAGGTACCCTCCTGGGCGACGATCAAATTTATAATGTAATTGTTACGGCGCATGCGTTCGTAATGATTTTCTTTATAGTAATACCAATCATGATTGGGGGATTTGGGAATTGATTAATTCCCCTAATGATTGGGGCCCCTGATATGGCCTTCCCTCGAATGAATAACATAAGTTTTTGACTCCTCCCTCCGTCCTTTTTCCTGCTTCTTGCCTCTTCTGGCGTAGAGTCCGGAGCCGGCACTGGGTGAACAGTTTATCCCCCTCTAGCCAGCAACCTGGCCCACGCCGGGGCATCTGTTGACCTAACTATCTTCTCCCTTCACCTTGCAGGGATCTCCTCCATTCTCGGAGCTATTAATTTTATTACAACAATCCTCAATATGAAGCCTCCTGCTATGTCCCAGTATCAAACCCCCCTTTTCGTCTGGTCTGTCTTAATTACGGCCGTTCTACTCCTCTTGTCCCTCCCTGTTCTCGCGGCTGGAATCACAATACTCCTCACGGATCGAAACCTAAATACGACCTTCTTTGACCCCGCAGGAGGTGGTGACCCCATTCTTTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon ocellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.A.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
It is a widely distributed species present and common in several protected areas. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is common throughout its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
It was driven to local extinction in some localities along the Brazilian coast due to extraction for the aquarium trade (L. Rocha pers. comm. 2009); however, its global population does not seem to be under any major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Present in several conservation areas throughout the Caribbean and Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spotfin butterflyfish

The spotfin butterflyfish, Chaetodon ocellatus, is a butterflyfish found in the western Atlantic Ocean, in the Gulf of Mexico and the Caribbean Sea.

The name is derived from the dark spot on the fish's dorsal fin. This, combined with a vertical, black bar through the eye, is designed to confuse predators.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!