Overview

Brief Summary

Chaetodon capistratus, the four-eyed butterfly fish or the foureye butterfly fish, is the type species of Chaetodon, one of the 10 genera in the conspicuous butterflyfish family Chaetodontidae. Chaetodon capistratus inhabits tropical coral reefs, sea grass beds and shallow waters in the Western Atlantic from North Carolina to Venezuela, and is the most common Carribean butterfly fish. The large white-ringed black eyespot at the base of the tail is more conspicuous that the fish’s actual eye, which is disguised with a black stripe - a color pattern thought to function in confusing predators about which is the front end. When cornered, C. capistratus will raise its dorsal fin in a threatening posture. Four-eyed butterfly fish eat small benthic invertebrates. Adults are usually seen as individuals or in pairs, as they are one of a few fish species that mate for life. These small (7.5 cm total length) fish are harvested for their popular place in the aquarium trade.

(Fessler and Westneat 2007; Rocha 2010; Froese and Pauly 2011; Patton; Wikipedia 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit shallow reefs and generally occurs singly or in pairs. Feed mainly on zoantharians, polychaete worms, gorgonians and tunicates. Easily approached (Ref. 9710). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Massachusetts, USA and Bermuda to West Indies and northern South America. Also Bahamas, Gulf of Mexico, and Antilles
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is known from the tropical northwestern Atlantic, where it ranges from the Carolinas (USA) to Venezuela. Populations occur in Bermuda and the Gulf of Mexico with vagrants being found as far north as Massachusetts (USA) in late summer (Burgess 1978, Carpenter 2002). It is found at depths of around 2-20 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda to West Indies and northern South America. Also Bahamas, Gulf of Mexico, and Antilles (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Chaetodon capistratus is found in the western waters of the tropical Atlantic. Its latitudinal ranges are along the North and South American coasts, stretching from Massachusetts to Brazil as well as the Gulf of Mexico and the Caribbean (Florida Museum of Natural History, 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 17 - 20; Analspines: 3; Analsoft rays: 16 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 26938))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Large black spot surrounded by a white ring on body below rear of dorsal fin. Narrow, dark, diagonal lines that meet at mid-side, forming series of forward-pointing chevrons (Ref. 26938). Upper profile of head steep and slightly concave due to protruding snout; light gray, shading to pale yellowish on sides; a black bar on head; pelvic fins yellow (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is relatively common in shallow rocky and reef areas with juveniles more common in seagrass beds (such as Thalassia) (Burgess 1978, Allen 1980, Carpenter 2002). Seen as individuals or in pairs. Feeds on small benthic invertebrates (Allen 1980, Carpenter 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They only occur in shallow coral reefs in depths of 2 - 20 meters. They seek shelter at night in crevices hiding from predators such as moray eel and various sharks (Florida Museum of Natural History, 2001).

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1901 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1304 samples.

Environmental ranges
  Depth range (m): 0 - 40
  Temperature range (°C): 26.134 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 4.285 - 4.724
  Phosphate (umol/l): 0.046 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 40

Temperature range (°C): 26.134 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 4.285 - 4.724

Phosphate (umol/l): 0.046 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 20m.
From 2 to 20 meters.

Habitat: reef-associated. Inhabits shallow reefs and generally occurs singly or in pairs. Feeds mainly on zoantharians, polychaete worms, gorgonians and tunicates. Easily approached (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits shallow reefs and generally occurs singly or in pairs. Feeds mainly on zoantharians, polychaete worms, gorgonians and tunicates. Easily approached (Ref. 9710). Is an active generalist when feeding on scleractinians (Ref. 8930). Sessile invertebrates feeder (Ref. 57616). Cleaned by Pederson's cleaner shrimp (Periclimenes pedersoni) and goby (Gobiosoma evelynae and others) as observed on the coral reefs in Bonaire, Netherlands Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Chaetodon capistratus is a browser who feeds on anthozoans preferring hexacoral such as scleractinians, anemones, and zoantharians (Birkeland and Neudecker, 1981). They are reef fishes that not only rely on the corals for habitat but also food. Anthozoans are readily available on coral reefs therefore it's not surprising that anthozoan tissue is their main diet. They are considered active generalists because anthozoans have minimal nutritional value and in order to make up for that loss, C. capistratus readily accepts fish eggs, worms or crustaceans when these foods are accessible. Having a mixing diet provides essential nutrients or a balanced diet for assimilation efficiency or both (Birkeland and Neudecker, 1981).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Hurleytrematoides Infestation 8. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hurleytrematoides Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaetodon capistratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chaetodon capistratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCTATCTAGTATTCGGTGCTTGAGCTGGGATAGTAGGCACCGCCTTAAGTCTGCTCATCCGAGCAGAGCTCAGCCAGCCAGGCACCCTCCTAGGCGACGATCAGATTTATAATGTAATCGTTACGGCACATGCGTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGGGGATTTGGGAATTGACTAATTCCCTTAATGATTGGGGCTCCGGACATGGCCTTCCCTCGAATGAATAACATAAGCTTTTGACTCCTCCCTCCATCCTTTTTCCTGCTTCTTGCCTCTTCTGGCGTAGAGTCCGGGGCCGGCACTGGATGAACAGTTTATCCTCCACTAGCCGGTAATCTAGCCCATGCCGGAGCATCCGTTGATCTAACTATCTTCTCCCTTCACCTTGCAGGGATCTCCTCCATTCTTGGGGCTWTCWATTTTATTACAACAATCCTCAACATGAAACCCCCTGCTATGTCCCAGTATCAAACTCCCCTTTTCGTCTGATCTGTTCTAATTACAGCCGTTTTACTTCTCTTGTCCCTCCCCGTTCTTGCAGCCGGAATTACAATGCTTCTTACAGACCGAAACCTTAATACAACCTTCTTTGACCCTGCAGGGGGCGGCGACCCCATTCTTTACCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.A.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution throughout the Caribbean. There are no major threats and there is no evidence of declines in the populations between 1993 and 2009.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is not listed on any of the hot lists. It is the most common of the butterflyfish in the West Indies.

US Federal List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is the most common butterflyfish in the Caribbean (Allen 1980, Carpenter 2002). From 1993-2009 no substantial declines in abundance were recorded (REEF Database) for this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. However habitat degradation has been implicated in causing declines in reef fishes in the Caribbean region (Paddack et al. 2009). Collection for the aquarium trade is limited and is not considered to be impacting the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within a number of marine protected areas. There is a need to monitor populations within the Caribbean to record any declines. Quantitative data on catches for the aquarium trade are required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Chaetodon capistratus are harvested for the aquarium trade. Their small size and attractiveness is ideal for an aquarium fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Foureye butterflyfish

The Four-eyed Butterflyfish (Chaetodon capistratus) is a butterflyfish (family Chaetodontidae). It is alternatively called the Foureye Butterflyfish. This species is found in the Western Atlantic from Massachusetts, USA and Bermuda to the West Indies and northern South America.[1]

Chaetodon capistratus is the type species of Chaetodon.[2] If this genus is split up as some have proposed, it will retain its present name like its closest relatives, which include the Banded Butterflyfish (C. striatus) and the Spot-finned Butterflyfish (C. ocellatus).[3]

Description and ecology[edit]

Four-eyed butterflyfish are deep-bodied and laterally compressed, with a single dorsal fin and a small mouth with tiny, bristle like teeth. The body is light grey, sometimes with a yellowish hue, and dark forward-pointing chevrons. The ventral fins are yellow. The species gets its common name from a large dark spot on the rear portion of each side of the body. This spot is surrounded by a brilliant white ring, resembling an eye. A black vertical bar on the head runs through the true eye, making it hard to see.[1]

This pattern may result in a predator confusing the back end of the fish for the front end. The Four-eyed Butterflyfish's first instinct when threatened is to flee, putting the false eye spot closer to the predator than the head. Most predators aim for the eyes, and this false eye spot tricks the predator into believing that the fish will flee tail first. When escape is not possible, a Four-eyed Butterflyfish will sometimes turn to face its aggressor, head lowered and spines fully erect, like a bull about to charge. This may serve to intimidate the other animal or may remind the predator that the butterflyfish is much too spiny to make a comfortable meal.

Four-eyed butterflyfish usually frequent shallow inshore waters, where they feed on a variety of invertebrates, mainly zoantharians, polychaete worms, gorgonians and tunicates. This fish is known for its uncanny ability to swim in and around coral heads and reefs. They are able to find their way through the most intricate passages by swimming on its side or even upside down. Like its relatives they mate for life and therefore they will often be seen in pairs. They are one of a few fish that mate for life[1]

Gallery[edit]

Footnotes[edit]

  1. ^ a b c FishBase (2008)
  2. ^ CoF (2008)
  3. ^ Fessler & Westneat (2007)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!