Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Compsilura concinnata is endoparasitoid of larva of Diaphora mendica

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Diaphora mendica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Diaphora mendica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGGTTTGAGCCGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCCCTTTCCTCTAATATTGCACATGGGGGAAGATCAGTTGATTTAGCTATTTTTTCCCTTCACTTAGCGGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTGTTTGTTTGAGCAGTGGGAATTACAGCTTTTCTACTTCTTCTTTCACTTCCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGACCCTGCGGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Diaphora mendica

The Muslin Moth (Diaphora mendica) is a moth of the family Arctiidae. It is found in the Palearctic ecozone east to Baikal Lake.

Illustration from John Curtis's British Entomology Volume 5

The wingspan is 28–38 mm. There is clear sexual dimorphism in the imago, with the male having a brownish gray colour and a forewing length of 14–17 mm, and the female being white and a having a forewing length of 17–19 mm. The female resembles Spilosoma lubricipeda, but that species has longer and smaller wings and a yellow and black back. The moth flies April to July depending on the location.

The larvae feed on Birch, Willow, Rumex, Lamium and Plantago.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!