Overview

Comprehensive Description

Biology

Occurs in ponds (Ref. 11229) and forest creeks rich in plant debris (Ref. 35381). Benthic fish which feeds on a wide range of food, including organic debris from the bottom. Spawns eggs on sandy substrate, in groups. Unlike the other species of Aspredinidae, the female does not carry her eggs (4,000 to 5,000 per spawning) in bags (cotylophores). It swims with undulating motion of its body and tail, rhythmically ejecting water from its opercles, thus resulting in a forward propulsion (Ref. 35381). Aquarium keeping: needs fine gravel or sand; minimum aquarium size 80 cm (Ref. 51539).
  • Friel, J.P. 2003 Aspredinidae (Banjo catfishes). p. 261-267. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36695)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found widespread in the Amazon River basin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South America: Amazon River basin.
  • Friel, J.P. 2003 Aspredinidae (Banjo catfishes). p. 261-267. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36695)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amazon River basin: Bolivia, Brazil and Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

11.0 cm SL (male/unsexed; (Ref. 36695))
  • Friel, J.P. 2003 Aspredinidae (Banjo catfishes). p. 261-267. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36695)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
B. coracoideus is a demersal (living at or near the bottom of the water body) species that occurs in ponds, forest creeks and small rivers rich in plant debris. It spawns eggs on sandy substrate, in groups. Unlike the other species of Aspredinidae, the female does not carry her eggs (4,000 to 5,000 per spawning) in bags (cotylophores).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 6.0 - 8.0; dH range: 5 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns in up to 30 cm deep water (Ref.1672).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bunocephalus coracoideus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCATCACACGCTGATTTTTTTCTACTAATCATAAAGACATTGGCACCCTATATTTAGTATTTGGTGCCTGAGCCGGCATAATCGGCACAGCCCTAAGTCTACTAATTCGAGCAGAACTAGCCCAACCAGGGGCCCTCCTCGGCGATGACCAAATTTATAACGTTATTGTAACTGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGCTTTGGGAATTGACTTGTTCCGCTTATGATTGGGGCCCCGGATATAGCATTTCCCCGAATAAATAACATAAGTTTCTGACTACTCCCCCCATCTTTTCTCCTTCTACTAGCCTCTTCTGGAGTTGAGGCAGGAGTAGGGACGGGGTGAACTGTTTACCCACCACTTGCCGGCAACCTAGCCCATGCAGGAGCCTCTGTGGACCTAGCAATTTTTTCTCTGCACTTGGCCGGGGTGTCCTCCATTCTAGGCGCAATTAATTTTATCACAACAATTATTAACATAAAACCCCCAGCCATCTCACAGTATCAAACACCCCTATTTGTATGAGCCATTATGATTACGGCTGTTCTTCTGCTCCTGTCCCTGCCAGTCTTAGCTGCTGGTATCACCATATTACTAACAGACCGTAACCTAAATACAACTTTCTTTGACCCCGCAGGAGGCGGAGATCCCATTTTATATCAGCACCTATTTTGATTCTTTGGACACCCAGAGGTATATATCTTAATTTTACCAGGATTCGGAATAATTTCCCACATTGTGGCCTATTACTCGGGCAAAAAAGAACCTTTTGGCTATATAGGAATAGTGTGAGCAATAATAGCAATTGGACTACTAGGCTTTATTGTATGGGCCCACCATATATTTACAGTTGGAATAGATGTAGATACTCGAGCCTACTTTACATCAGCAACGATAATCATTGCAATTCCAACTGGAGTAAAAGTATTTAGCTGGCTGGCCACTCTACACGGGGGATCCATTAAATGAGAGACTCCAATATTATGGGCCATTGGTTTTATTTTCTTATTTACTGTAGGAGGTCTAACTGGAATTGTATTAGCTAATTCATCCCTAGATATTGTATTACATGATACCTATTATGTAGTTGCCCATTTCCACTATGTACTGTCAATAGGAGCCGTCTTTGCAATTATAGGAGCATTCGTACACTGATTCCCCCTGTTTACAGGATATACAATACATGACACATGAACAAAAATTCATTTTGGTACAATATTTGTAGGTGTCAACCTAACTTTCTTCCCTCAACATTTTCTAGGGCTAGCCGGTATACCACGGCGTTACTCAGATTATCCAGATGCCTACTCATTATGAAATATTATCTCCTCAATTGGTTCAATAATTTCCCTAACAGCAGTCGTAATATTCCTATACATTTTATGAGAAGCCTTTGCTGCCAAACGAGAAGTTCTCTCTGTAGAACTAACCGCCACTAATGCAGAATGACTTCATGGCTGCCCCCCTCCTTATCACACATTTGAAGAGCCAGCCTTTGTACAAGTACAAACAAATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bunocephalus coracoideus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Reis, R & Lima, F.

Reviewer/s
Collen, B., Darwall, W., Ram, M. & Smith, K. (SRLI Freshwater Fish Evaluation Workshop)

Contributor/s

Justification
Assessed as Least Concern due to its wide distribution, abundance, and the lack of any known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Probably the most widespread and common species in the genus.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no threats currently affecting the species gloabally. Although it is a common pet, it is bred in captivity and the wild populations appear unharmed by this trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bunocephalus coracoideus

Bunocephalus coracoideus, the Guitarrito, is a species of banjo catfish found in the Amazon River basin. It occurs in Bolivia, Brazil, Peru and Uruguay where it is found in ponds and creeks that contain a large quantity of plant debris. It is quite popular in the aquarium trade. Both male and female reaches a length of 12.0 cm.They are generally very peaceful, however it is a predatory to small fish, such as young fry.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!